survival of newly formed cells protein kinase c and its adapter proteins
A novel membrane pool of protein kinase c and its role in mammalian cell signaling
Ngày tải lên :
12/09/2015, 21:10
... investigation of the sequence of the proteins Due to the differences in structural identity and composition of C1 and C2 domains, cPKCs can be regulated by both diacylglycerol and calcium, while nPKCs can ... anti-apoptotic effect Activation of ERK/MAPK and phosphorylation of anti-apoptotic protein Bcl2 by PKCα233,236,239 mediates the anti-apoptotic effect of PKCα in NIH3T3 cells, COS7 cells and HL60 cells ... junctions are specific cell-to-cell junctions that can connect the cytoplasms of adjacent cells via water-filled channels 1.1.2 Cell signaling machinery 1.1.2.1 Receptors of the signals The receptors...
- 221
- 308
- 0
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
Ngày tải lên :
22/02/2014, 04:20
... enhancing effect of TS on LPS/IFN-induced NO production is caused by enhancement of iNOS protein induction Effects of a-T and its derivatives on the enhancement by TS of LPS/IFN-induced NO production ... the enhancement by TS of LPS/IFN-induced NO production Protein kinases such as PKA and PKC, and various factors such as tumor necrosis factor receptor (TRAF6) and myeloid differentiation protein ... kB-dependent mechanism J Immunol 161, 6206– 6214 31 Chen, C. -C. , Chiu, K.-T., Sun, Y.-T & Chen, W. -C (1999) Role of the cyclic AMP -protein kinase a pathway in lipopolysaccharideinduced nitric oxide...
- 6
- 494
- 0
Báo cáo khoa học: " A specific inhibitor of protein kinase CK2 delays gamma-H2Ax foci removal and reduces clonogenic survival of irradiated mammalian cells" pot
Ngày tải lên :
09/08/2014, 09:20
... higher ratio of nuclear to cytosolic activity of CK2 in cancer cells than in normal cells [30] Despite the observed difference in basal CK2 localization, the cytotoxic effect of CK2 inhibition was ... means of fluorescence microscopy (100× magnification and manual focal plane scanning) Foci present in 50 cells were counted for each sample Flow cytometry and apoptosis measurement Treated cells ... Filhol O, Cochet C: Cellular functions of protein kinase CK2: a dynamic affair Cell Mol Life Sci 2009, 66:1830-1839 22 Yamane K, Kinsella TJ: CK2 inhibits apoptosis and changes ist cellular localisation...
- 13
- 289
- 0
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
Ngày tải lên :
08/03/2014, 08:20
... (pBSMARCKS 52 nt) was constructed by annealing the two synthetic oligonucleotides (sense: 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; ... transfection with a chimeric luciferase-MARCKS construct and for transient transfection with the cDNAs coding for human HuD and HuR The mouse embryonic carcinoma cell line PCC7-Mz1 is a subclone of ... C and the supernatants were removed and stored at )20 C For fractionation into nuclear and cytosolic extracts the cells were rinsed once with ice-cold NaCl/Pi, scraped off the dish in mL NaCl/Pi...
- 16
- 754
- 0
Báo cáo khóa học: Phospholipase C, protein kinase C, Ca 2+ /calmodulin-dependent protein kinase II, and redox state are involved in epigallocatechin gallate-induced phospholipase D activation in human astroglioma cells ppt
Ngày tải lên :
16/03/2014, 16:20
... 5A) Using confocal immunofluorescence microscopy, we confirmed that PLC -c1 translocation to membrane regions increased after EGCG treatment Furthermore, colocalization of PLD1 and PLC -c1 increased ... cells could explain the activation of PLD U87 cells were incubated with DCFH to test whether EGCG increases ROS production ROS produced in cells causes oxidation of DCFH, yielding the fluorescent ... state of the cells EGCG treatment decreased the GSH concentration, and the decrease in GSH content by EGCG in cells pretreated with N-acetylcysteine was recovered, suggesting that treatment of cells...
- 11
- 279
- 0
Báo cáo khoa học: Modulation of the Arabidopsis KAT1 channel by an activator of protein kinase C in Xenopus laevis oocytes potx
Ngày tải lên :
22/03/2014, 21:21
... PKC can be classified as conventional PKCs (cPKC; a, bI, bII and c) , which contain a putative Ca2+-binding site, novel PKCs (nPKC; d, h, g and e), which lack Ca2+-binding sites, and atypical PKCs ... channel K+ channel (Kv), Kv long QT, small-conductance calcium-activated K+ channel, large-conductance Ca2 +and voltage-regulated K+ channel, hyperpolarizationactivated cyclic nucleotide gated channel, ... KAT1 current amplitudes decrease in the presence of a soybean calcium-dependent protein kinase (CDPK) [8] Consistent with this, CDPKs in guard cells are involved in Ca2+ and anion channel activation...
- 11
- 531
- 0
Báo cáo khoa học: Differential involvement of protein kinase C alpha and epsilon in the regulated secretion of soluble amyloid precursor protein docx
Ngày tải lên :
23/03/2014, 13:20
... translocation takes place we subjected the cells to immunocytochemical analysis and confocal microscopy PKCa (Fig 2) and PKCe (Fig 3) were detected predominantly in the cytoplasm of untreated cells; ... SYa4 and SYDe neuroblastoma cells Incubation of the cells for h in the presence of increasing concentrations of carbachol (10 lM, 100 lM, mM) was followed by Western blot of proteins collected ... downregulation of PKCa reduces the sensitivity of the cells to direct PKC activation Higher concentrations of PMA are necessary to elicit a significant secretion of sAPPa in SYa4 cells, perhaps necessary...
- 8
- 458
- 0
báo cáo khoa học: "The expression and role of protein kinase C (PKC) epsilon in clear cell renal cell carcinoma" ppt
Ngày tải lên :
10/08/2014, 10:21
... Journal of Experimental & Clinical Cancer Research 2011, 30:88 http://www.jeccr.com/content/30/1/88 crucial for survival of clear cell RCC cells and may serve as a therapeutic target of RCC Methods ... radical nephrectomy or partial resection Of the 128 RCC samples, 10 were papillary RCC, 10 were chromophobe RCC, and 108 were clear cell RCC according to the 2002 AJCC/UICC classification The clear ... PKCε may contribute to the resistance of clear cell RCC cells to cytotoxic drugs Figure Changes of caspase-3 activity in 769P cells after PKCε downregulated and cytotoxic drug treatment 769P cells...
- 9
- 308
- 0
Báo cáo y học: " Protein kinase C promotes restoration of calcium homeostasis to platelet activating factor-stimulated human neutrophils by inhibition of phospholipase C" ppt
Ngày tải lên :
11/08/2014, 08:22
... IP3 production and promoting the clearance of cytosolic Ca2+, with associated decreased production of LTB4 Materials and methods Chemicals and reagents The highly selective protein kinase C inhibitor, ... Effects of staurosporine and GF10903X, in the presence or absence of rolipram, on cytosolic Ca2+ concentrations of PAFactivated neutrophils, as well as the effects of GF10903X on cytosolic Ca2+ concentrations ... before activation, on the rate and magnitude of Ca2+ influx Radiometric assessment of Ca2+ fluxes 45Ca2+ (Calcium-45 chloride, specific activity 18.53 mCi.mg-1, Perkin Elmer Life Sciences, Inc.)...
- 9
- 331
- 0
Role of the c terminus of protein kinase c related kinase in cell signalling
Ngày tải lên :
14/09/2015, 12:01
... cAMP cDNA CDK CL CO COS cPKC C1 Degree Celcius Calmodulin Calmodulin Kinase Adenosine 3’, 5’- cyclic monophosphate complimentary deoxyribonucleic acid Cyclin-dependent kinases Cardiolipin carbon ... hydrophobic motif are critical for the catalytic competence and function of Protein Kinase C α”, Journal of Biological Chemistry, 2006 Oct 13;281(41): 30768-81 xiii Summary Protein Kinase C- related kinases ... separate and unique functions in the cell 1.3.3.4 Fatty acids In the absence of PS and Ca2+, cis-unsaturated fatty acids such as arachidonic, linoleic, linolenic and oleic acid can activate PKC to...
- 240
- 209
- 0
Brutons tyrosine kinase and protein kinase c µ are required for TLR7 9 induced IKKα and IRF 1 activation and interferon β production in conventional dendritic cells
Ngày tải lên :
23/09/2015, 14:47
... 5’CAGCTCCAAGAAAGGACGAAC-3’ and 5’-GGCAGTGTAACTCTTCTGCAT-3’; b-actin, 59-AGATGACCCAGATCATGTTTGAGA-39 and 59-CACAGCCTGGATGGCTACGTA-39 Wild type C5 7BL/6 mice were obtained from the BRC, and btk2/2 mice were obtained ... Research (NACLAR) of Singapore The protocol was approved by the Institutional Animal Care and Use Committee of the Biological Resource Center (BRC) of Agency for Science, Technology and Research ... btk2/2 CDC (Fig 4C) Thus, PKCm was activated by TLR7/9 engagement in cDC and the absence of BTK in cDC specifically impaired the activation of PKCm These data suggest that PKCm is involved and acts...
- 9
- 255
- 0
Tài liệu Báo cáo khoa học: The diacylglycerol and protein kinase C pathways are not involved in insulin signalling in primary rat hepatocytes doc
Ngày tải lên :
20/02/2014, 02:21
... e) protein kinase C isoforms on insulin-stimulated translocation of epitope-tagged GLUT4 glucose transporters in rat adipocytes: speci c interchangeable effects of protein kinases C- Z and C- 1 ... stimulation of rat hepatocytes with ATP or PLC was speci c for certain molecular species, diacyl, alkylacyl and alk-1-enylacyl subclasses were separated and their molecular species composition ... PMA-treated cells were run on each gel for comparison), and (d) comparison of bands after incubation of a membrane blot with buffer in the presence or absence of an antigen (PKC isoform) of the respective...
- 12
- 592
- 0
Báo cáo khoa học: Identification of multiple isoforms of the cAMP-dependent protein kinase catalytic subunit in the bivalve mollusc Mytilus galloprovincialis potx
Ngày tải lên :
07/03/2014, 06:20
... 1910.82 1605.88 a Present in spectra from Bovine Ca, C1 C6 Bovine Ca, C1 C6 C1 C6 C1 C6 C1 C6 C1 C6 C1 C6 C1 C6 C1 C6 C1 C6 C1 C6 C1 C6 C2 , C3 , C5 , C6 De novo peptide sequence [I ⁄ L][I ⁄ L]DKQK T[I ... the corresponding tissue (5 unitsÆmg)1 protein) Samples of C1 , C2 and C3 were from fractions 20, 22 and 29 of the Fig 1A chromatogram, respectively, and samples of C4 and C5 + C6 were from fractions ... the catalytic subunit of mouse cAMP-dependent protein kinase Proc Natl Acad Sci USA 83, 1300– 1304 20 Uhler MD, Chrivia JC & McKnight GS (1986) Evidence for a second isoform of the catalytic subunit...
- 11
- 509
- 0
Báo cáo khoa học: Purification and structural study of the b form of human cAMP-dependent protein kinase inhibitor pdf
Ngày tải lên :
07/03/2014, 15:20
... the 1666 and 1247 cm)1 bands are the characteristic frequencies of the random coil structure Meanwhile, the 1682 and 1255 cm)1 bands can be assigned to extended chain or b-turn structure [21] ... inhibitory and nuclear export function Protein Sci 8, 545–553 Collins, S.O & Uhler, M.D (1997) Characterization of PKI gamma, a novel isoform of the protein kinase inhibitor of cAMPdependent protein kinase ... export of proteins from the nucleus Cell 82, 463–473 Olsen, S.R & Uhler, M.D (1991) Isolation and characterization of cDNA clones for an inhibitor protein of cAMP-dependent protein kinase J Biol Chem...
- 6
- 531
- 0
Báo cáo khoa học: Covalent activation of heart AMP-activated protein kinase in response to physiological concentrations of long-chain fatty acids docx
Ngày tải lên :
07/03/2014, 15:20
... phosphorylation of the 280 kDa isoform of acetyl-CoA carboxylase in rat cardiac myocytes: evidence that cAMP-dependent protein kinase mediates effects of beta-adrenergic stimulation Biochem J 341, ... (2001) Pyruvate/dichoroacetate supply during reperfusion accelerates recovery of cardiac energetics and improves mechanical function following cardioplegic arrest Eur J Cardio-Thorac Surg 19, 865–872 ... perfusate fatty acid concentration was zero This is technically the correct control but is unreal because a plasma NEFA concentration of zero will not occur physiologically In fact hearts started...
- 10
- 551
- 0
Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc
Ngày tải lên :
08/03/2014, 08:20
... primer (5¢-TCAGGAGCTAA GGAAGCTAAAATGGTGAGCAAGGGCGAG-3¢) and primer (5¢-CCGCTCGAGTTACTTGTACAGCTCGT CCATGCC-3¢) The splice-overlap PCR-product was cloned into pUC18 (NEB) and subsequently cloned into ... (5¢-CCCAAGCTTGGGTGCCCCGCGC AGGGTCGCG-3¢) and primer (5¢-GTACTGTTTCTT CTTCAGCATCACC-3¢) The GAL4-VP16 DNA fragment (678 bp) was produced by PCR from pGAL4-VP16 [26] (a gift from G E O Muscat, ... pSP72 The hygromycin resistance gene was amplified from the pCEP4 plasmid (Invitrogen) with primer (5¢-GGACCAGACCCCACGCAACG-3¢) and primer 10 (5¢-GCCCTGCTTCATCCCCGTGG-3¢) and cloned into the pSP72/5GAL-E1bEGFP...
- 12
- 471
- 0
Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt
Ngày tải lên :
23/03/2014, 06:20
... accuaaagca uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; ... gccuccauuugauggugaagaugaa; PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy Pontoise, France) ... Quantification of cadmium accumulation in cells (A) Comparison of intracellular cadmium accumulation from medium containing lM CdCl2 between control cells (Ø) and 100 ngÆmL)1 PMA-treated cells...
- 13
- 331
- 0
Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc
Ngày tải lên :
23/03/2014, 11:20
... ACTTTCTRCTCT ⁄ CACTTGCCATTGCTTTTATCA and ligated into SmaI site of pUC 18 vector The E coli pGEX–mTSSK3 or pGEX–hTSSK3 plasmids were constructed using pGEX)4T-2, which expresses the target protein ... (GCGCTGTCGACCATGGAGGACTT TCTGCTCT ⁄ CATTGAATTCCTCAAGTGCTTGCTAGC CATG) The forward (5¢) primer contained a SalI site, whereas the reverse (3¢) primer contained an EcoRI site The amplified products were ... development of male contraceptives, given the recent therapeutic success of small inhibitors of protein kinases such as imatinib Among testis-speci c kinases, some appeared indispensable, such as casein...
- 14
- 374
- 0
Báo cáo khoa học: Identification of the heparin-binding domains of the interferon-induced protein kinase, PKR pptx
Ngày tải lên :
23/03/2014, 13:20
... TTCAAAGCAAAAC-3¢, ATD antisense: 5¢-GCGGATCCCATTTACATGATCA AGTTTTGC-3¢; CTD sense: 5¢-GCTCTAGAGCCATGGCGATTCATA GAGATCTTAAGCC-3¢, CTD antisense: 5¢-GCGGATCCGAAGTTCAGCAAGA ATTAGCCC-3¢ The corresponding regions ... oligonucleotides according to the instructions provided with the kit: K299A: 5¢-GTTATTAAACGTGTTGCATATAATAAC GAG-3¢; DM: 5¢-ACTTACGTTATTGCACGTGTTGCAT ATAATAACGAG-3¢; hep2: 5¢-CTGAAAAATGATGGAG AGCTCACAGAGAGTAAGGGAACTTTG-3¢ ... absence of activator; ds lanes, proteins bound to the beads in the presence of dsRNA and hep lanes, proteins bound to the beads in the presence of heparin The names of the proteins are indicated...
- 15
- 424
- 0
Báo cáo khoa học: Death-associated protein kinase (DAPK) and signal transduction: fine-tuning of autophagy in Caenorhabditis elegans homeostasis doc
Ngày tải lên :
29/03/2014, 08:20
... release of internal contents [48] In C elegans, gain -of- function mutations of mec-4, deg-1 or deg-3, which encode speci c ion channel subunits, lead to necrotic-like degeneration of a subset of neurons ... elegans Calcineurin Calcineurin is a serine ⁄ threonine phosphatase that couples calcium signals to changes in gene transcription by regulating the nuclear factor of activated T cells family of transcription ... amino acid signaling, (b) AMP-activated protein kinase, which activates autophagy through the inhibition of mTOR signaling, (c) Bcl-2, which binds to Beclin and inhibits autophagy, (d) BH3 only proteins, ...
- 8
- 376
- 0