surface mechanical measurements at the nanoscale
electrochemistry at the nanoscale, 2009, p.476
... electrode surface is shown, the atomic lattice at the surface is fully resolved, including the small lateral and vertical modulation in the position of the Au surface atoms caused by the surface ... a surface of different nature The onset of the interaction between the tip and the surface produces an elongation of the tip at the atomic scale – the so-called jump to contact – that generates ... in the potential range negative of the ordered phase, only the periodicity of the substrate lattice remains visible in the STM image The position of the adlattice relative to the substrate atoms...
- 476
- 854
- 0
chirality at the nanoscale. nanoparticles, surfaces, materials and more, 2009, p.430
... to appreciate that there is a fundamental distinction between magnetic optical rotation and the natural optical rotation that is associated with handedness in the microstructure That the two phenomena ... say about chirality at all levels: the experiments that show up optical activity observables, the objects generating these observables and the nature of the quantum states that these objects must ... Cataloguing-in-Publication Data A catalogue record for this book is available from the British Library Bibliographic information published by the Deutsche Nationalbibliothek The Deutsche Nationalbibliothek lists...
- 430
- 419
- 0
governing at the nanoscale, 2006, p.89
... Natalie Bell and Sarah Hoyle at the Natural History Museum for hosting our final workshop Our ability Demos Governing at the Nanoscale to communicate the results of the project has been greatly ... that we should be able to work through an enlarged partnership.63 Demos 37 Governing at the Nanoscale One researcher at Cambridge suggested that working at the nanoscale necessitated collaborations ... nanotechnologies were to gather momentum in the UK The focus groups generated a rich collection of insights, which are summarised in chapter Demos 13 Governing at the Nanoscale The final phase of the research...
- 89
- 303
- 0
Báo cáo y học: "Mechanical complications and reconstruction strategies at the site of hip spacer implantation"
... antibiotic concentrations due to the continuous friction of the articulating components Cement debris can be then easily removed at the time of the prosthesis reimplantation via pulsatile lavage and ... elegant method that treats both the fracture and the infection (Figure 8) At the time of prosthesis reimplantation, the spacer head can be easily removed and the modular prosthesis parts (neck ... and at stable femoral fixation, the spacer itself may dislocate out from the hip socket In these cases, specific attention should be paid on whether a wrong motion of the hip joint led to the...
- 6
- 455
- 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx
... AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA ... ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA ... CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG CAAAGCGATCTTATTCTTTT...
- 15
- 475
- 0
Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx
... Volume of the book series Biomathematical and Biomechanical Modeling of the Circulatory and Ventilatory Systems aims at presenting major sets of signaling receptors mainly located at the plasma ... (e.g., fatty and bile acids and sterols), and xenobiotics M Thiriet, Signaling at the Cell Surface in the Circulatory and Ventilatory Systems, Biomathematical and Biomechanical Modeling of the Circulatory ... Bachelard) The set of books devoted to Circulatory and Ventilatory Systems in the framework of Biomathematical and Biomechanical Modeling aims at providing basic knowledge and state of the art on the...
- 999
- 3,169
- 0
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot
... between the substrate and the active oxygen species to generate product Previous data have led to the conclusion that the species responsible for oxygenation of substrate is the diferryl intermediate ... shows the effect of increasing catalase concentrations (0, 2.4, 4.8 and 7.2 lM, respectively) The effect of ventilating the reaction at the highest catalase concentration was also investigated as ... of the products of substrate oxygenation by the adsorbed MMOH was achieved by holding the potential at )0.5 V for 30 in the presence of substrate and then removing the liquid (50 lL) from the...
- 6
- 464
- 0
Báo cáo khoa học: "Mechanical Translation Work at the University of Michigan" potx
... to cooperate on such matters Furthermore, the change will probably not involve any expense, since the printers of these journals have hundreds of fonts already and can continue to use the discarded ... necessary to convince the publishers of technical journals to use it This should not present nearly so much difficulty as many pro- posals for international standardization, since these people are ... 41 KOUTSOUDAS from page 34 Application to non-Roman-alphabet languages (especially Russian) would be a possibility for the more distant future After a suitable standard font...
- 2
- 222
- 0
Báo cáo hóa học: " Mapping of immunogenic and protein-interacting regions at the surface of the seven-bladed β-propeller domain of the HIV-1 cellular interactor EED" pptx
... regions of the host genome [22-25] Thus, at the early phase of the HIV-1 life cycle, EED might play a role in targeting the regions of proviral DNA integration into the host chromatin At the late steps ... at the surface of the EED protein The template used was the β subunit of the bovine signal-transducing G protein (Gβ), of which crystal structure has been determined [27,28] However, due to the ... confined to the flexible loop IVd-Va on the upper face of the β-propeller, but also included the short, rigid β-strand IVd and the neighboring loop IVd-Va, located on the lateral face of the β-propeller...
- 8
- 378
- 0
Báo cáo hóa học: "Mechanical tuning of molecular machines for nucleotide recognition at the air-water interface" pot
... between and the phosphate group within the nucleotide becomes less important Hence, on the surface of pure water, there exists a rather ambiguous interaction between and the base portion of the nucleotides, ... monolayer and the nucleotides In addition, the complexation of Li+ ion stabilizes the conformation of the cyclononane ring of 1, resulting in a rather simple situation of discrimination amongst the nucleotides ... by the triazacyclononane ring causes two variations in the characteristics of the recognition system The presence of Li+ ion at the core of ensures strong electrostatic interaction between the...
- 6
- 243
- 0
Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx
... at room temperature demonstrating that incubation at a higher temperature reduced unspecific attachment of this virus to CHO cells, while attachment to CHO-CAR, CHO-DAF and HeLa remained at the ... that gradient purification may alter the structure of the virion or remove components that affect the interactions with the cell surface The observed differences suggest that the interaction between ... studying viruses in their natural state rather than using highly purified viruses for these types of studies The potential to circumvent purification and radiolabeling of viruses gives the possibility...
- 6
- 230
- 0
Using pictures in teaching vocabulary of English to the second year students of Mechanical Department at Haiphong Industrial Vocational College
... including the rationale, the aims, the scope, the method and the design of the thesis Part B presents the development consisting of four chapters: Chapter deals with the theoretical background of the ... analyzed statistically, while the qualitative data were collected from the class observation Survey questionnaires were used to collect information and evidence for study with the hope that the research ... presentation and discussion consisting of the data collected from the survey questionnaires and class observation and discussion of these data Part C is the conclusion of the study consisting of the...
- 4
- 560
- 3
Mechanical insights into the physiological functions of claudin mediated adhesion at tight junctions a
... significant bias to the simulation as the cumulative distribution function of the loading rate fits well between the experimental data and MC simulation (Figure 6a) Since the simulated distribution was ... different reactive coordinates Here, the geometric locations for their bound states were plotted on the same reactive coordinates for the purpose of comparison All dissociation pathways were not sketched ... hierarchy of mechanical strengths with two bound states.12 Here, we showed that there is only a single stable bound state for the dissociation of the Cldn1/Cldn1 complex within the range of tested...
- 6
- 198
- 0
Mechanical insights into the physiological functions of claudin mediated adhesion at tight junctions b
... where rf is the rate of force application (i.e., loading rate), kB is the Boltzmann constant, T is the absolute temperature, koff is the unstressed dissociation constant, and xβ is the reactive ... significant bias to the simulation as the cumulative distribution function of the loading rate agrees well between experimental data and MC simulation (Fig 6a) Since single dissociation rate and reactive ... bounded complex The geometry of the conceptual energy landscape for the dissociation pathway can be constructed based on these kinetic parameters The geometric locations of their bound states were...
- 11
- 186
- 0
Mechanical insights into the physiological functions of claudin mediated adhesion at tight junctions c
... deviations to the simulation as the cumulative distribution function of the loading rate agrees well between experimental data and MC simulation (Fig 6a) The good agreement between computational ... complex These kinetic parameters can be further used to construct the geometry of the conceptual energy landscape for the dissociation pathway To compare the topography of the energy landscapes of the ... reactive coordinates Here, the geometric locations for their bound states in different pH conditions were plotted on the same reactive coordinates for the purpose of comparison Cldn2 pairs at different...
- 9
- 307
- 0
STUDY ON LATTICE AND ELECTRONIC STRUCTURES AT THE SURFACE OF BATIO3 THIN FILMS BY DFT METHOD
... sites The other is that the crystal reconstruction due to the coordination number imperfection of surface atoms (the surface relaxation) leads to the re-contribution of the electronic structure The ... than the BaO terminated ones Moreover, the termination is also the importance factor to predict the surface electric polarization properties of BaTiO3 : the surface polarization of TiO2 terminated ... than atom by atom [26, 27, 28] Then, the break of the TiO6 octahedral coordination at the surface should lead to a larger structural reconstruction in the case of TiO6 terminated film than the...
- 12
- 442
- 0
Báo cáo y học: "Effects of Losartan on expression of connexins at the early stage of atherosclerosis in rabbits"
... demonstrated that rats lack of Cx43 expression showed 50% lower rate of attack with atherosclerotic plaque compared with normal rats (9) Our study demonstrates an association of the formation of atherosclerosis ... in the high fat diet group than in the normal group Vessel wall is in the condition of rugosity and the yellow atheromatous plaques were found in the lumens of high fat diet group However, the ... connections The present study aimed to detect the expression of Cx40 and Cx43 in the artery at early stage of high fat diet induced atherosclerosis and to investigate the effects of AT1 antagonist...
- 8
- 467
- 0
Luận văn tiếng Anh EMPLOYEE COMPENSATION AT THE HO CHI MINH MUSEUM CONSTRUCTION JSC.doc
... in the later part Also, quantitative and qualitative studies have been conducted based on statistics information Data analysis is chiefly based on qualitative approach and interpretation of the ... Company needs to determine the cause, whether it is due to the impact of the crisis, or the new corporate income tax payable, or other reason, and determine the main causes Then the Company should base ... period of time is referred to as the wage rate In the planned economy, wage is the price of neither labor power nor goods, neither in the private nor public sector In the market economy, wage is understood...
- 96
- 2,121
- 13
Beginning at the End
... but that was it Then the engines turned on Twenty minutes later the pilot came on and said that they were preparing for take off (What the hell was the twenty minutes prior for?) Finally the plane ... take the luggage up to the house for fear of what her grandfather would Obviously he didn‟t miss the gesture since he smiled smugly at her as he grabbed the suitcases from the trunk The boot’, they ... been busy finding God at that moment she would have attempted to incinerate the horrible woman with a fiery glare Five minutes later the pilot announced they would be beginning the final decent Nicole...
- 11
- 579
- 0
Designing an esp syllabus for the second-year students of library study at the national teachers training college
... has the authors name or other persons or institutions The second has the title of the book or other item on the top line the third has the subject of the item on the top line Figure : Organization ... collection The first type has the authors name or other persons or institutions that contributed to the work on the top line The second has the title of the book or other item on the top line , and the ... study at the NTTC is the subject matter chosen for my thesis Aims and Objectives The study aims at designing an appropriate ESP syllabus for the second year students of library study at the NTTC...
- 76
- 737
- 4
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25