suggested contents of a mold manual

... dimensions Disadvantages: postoperation for sprue removal, visible gate mark Molding Sprue^ Parting line Application: for parts with large areas such as plates and strips Edge gate Gate Advantages: no ... smaller parts in multi-cavity molds and for elastic materials Sprue Parting line Advantages: automatic gate removal Disadvantages.for simple parts only because of high pressure loss Tunnel gate Molding ... center gating Advantages: automatic gate removal Disadvantages: large volume of Gate Molding scrap, higher mold costs Parting line Pinpoint gate (with reversed sprue) Runnerless gating Application:for...

Ngày tải lên: 13/10/2016, 22:32

... the pseudoplastic range for —> 00 (Figure 5.75) This Carreau model has the advantage that it correctly reflects the actual material behavior over a broader shear-rate range than that afforded by ... that completely laminar flow is maintained even in the gate This means that, above all, a flow path close to the wall remains there At the point of branching, the core material penetrates against ... path to molded part 5.10 Special Phenomena Associated with Multiple Gating To discover particular phenomena of materials, a mold was developed [5.52] based on the theoretical considerations above...

Ngày tải lên: 13/10/2016, 22:33

... [Journal of Pharmaceutical and Biomedical Analysis 41 (2006) 274-279], (B) [Journal of Pharmaceutical and Biomedical Analysis 48 (2008) 1361-1367], (C) [Journal of Pharmaceutical and Biomedical Analysis ... The similarities of chromatograms of 10 samples (n = 3) Additional file 3: PDA Chromatograms standard compounds (A) and a XST injection (C), and total ion current chromatograms of standard compounds ... nebulizing gas, high purity nitrogen (N ); ion spray voltage, -4.5 kV; sheath gas (N2 ) at a flow rate of 60 arbitrary units; auxiliary gas (N2) at a flow rate of 20 arbitrary units; capillary temperature,...

Ngày tải lên: 13/08/2014, 14:20

... and  mud  flows  to  appear  as  a particular  case  similar  to  one  of the  Bac  Ha  Tableland  SW  slopes.  The  case  of Lay  Nua  shows  us  another  important  factor  of debris  and mud flows forming.  ... of about  4  km  has  to  bear  terrible  attacks  of debris  and  mud  flows,  though  the  former  Lai  Chau  Town  area has also suffered heavy losses, but because  of an  another  catastrophe,  ... (limestone  of the  Ban  Pap  Formation  (D1-2 bp),  aphyric  basalt,  porphyritic  basalt,  basaltic  agglomerate  of the  Cam  Thuy  Formation  (P3 ct)),  and  of the  remarkable  original  height ...

Ngày tải lên: 22/03/2014, 12:20

... purification of His-tagged proteins and presents a major limitation for broad application of such materials In this regard, optimization and evaluation of commercially available matrices is mandatory, ... dilution of hoarse-radish peroxidase (HRP)-conjugated rabbit anti-goat or sheep anti-rabbit (Avicenna Research Institute, Tehran, Iran) for h Membrane was then washed as above and specific bands ... biomedicine Biomagn Res Technol 2003, 1:2 Sakamoto S, Kabe Y, Hatakeyama M, Yamaguchi Y, Handa H: Development and application of high-performance affinity beads: toward chemical biology and drug discovery...

Ngày tải lên: 11/08/2014, 00:23

... Department of Health and Aged Care (DHAC): National Physical Activity Guidelines for Australians Commonwealth Department of Health and Ageing Canberra: Department of Health and Ageing; 1999 Vandelanotte ... Institute for Health and Social Science Research Vandelanotte was supported by a National Health and Medical Research Council of Australia (#519778) and National Heart Foundation of Australia (#PH 07B ... Queensland, Australia 2Faculty of Physical Education and Recreation, University of Alberta, W1-34 Van Vliet Centre, Edmonton, Alberta, Canada Authors’ contributions CV was involved in conceptualization,...

Ngày tải lên: 14/08/2014, 08:20

... explain the higher antibacterial activity on Gram-negative bacteria for parabutoporin compared to opistoporin Also with magainin analogs, an increase in antibacterial activity against Gram-negative ... (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and of the first 28 amino acids of the ... being least active against S marcescens Mastoparan is far less active in inhibiting growth of Gram-negative bacteria and melittin is only active against three of the Gram-negative bacteria at the...

Ngày tải lên: 21/02/2014, 15:20

... Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia and Putra Jaya form the Federal territories ... meters and with a tidal stream of over knots The West Coast of Peninsular Malaysia has an equatorial climate, with an average annual rainfall of more than 2500mm and a daily temperature that ranges ... include: Friends of the Earth (Sahabat Alam Malaysia), World Wildlife Fund for Nature (Malaysia), Malaysian Institute of Marine Affairs (MIMA), Malaysian Nature Society, Malaysian Fisheries Society,...

Ngày tải lên: 06/03/2014, 15:21

... extension at 72 °C for 10 The primers for lac1 PLAC1F (5¢-AGCTTT CATTCCCAGTGATTG-3¢) and PLAC1R (5¢-AACGAG CTCAAGTACAAATGACT-3¢) were designed according to our cloned cDNA (GenBank Accession No AY249052) ... CATAAA) are in white on a black background Ó FEBS 2003 Laccase gene from Volvariella volvacea (Eur J Biochem 271) 323 Fig Alignment of deduced amino acid sequences of lac1 and other fungal laccases ... primordia (day 12), appearance of pinheads (day 14), button stage (day 18), egg stage (day 21), elongation stage (day 22), and mature fruiting body (day 23) The results of RT-PCR analysis of gene transcription...

Ngày tải lên: 07/03/2014, 15:20

... (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 (2005) 4091–4102 ª 2005 FEBS 4099 Molecular characterization ... Molecular characterization of ANKHD1 splice variant studies blast searches of VBARP revealed that this protein has homology to human ankyrin repeat and KH domain containing 1(ANKHD1) variants, and ... 5¢-CTAGACTCGAGCCTAAT TTATATTTGCTCCTTGTGC-3¢ b-Actin primers were designed as follows: forward 5¢-CTACAATGAGCTGCG TGT-3¢ and reverse 5¢-AAGGAAGGCTGGAAGAGT-3¢ Cell survival and apoptosis analysis In vivo interaction...

Ngày tải lên: 07/03/2014, 21:20

... same Ala substitution was reported to cause a significant decrease in biological activities of [Ala8]NKA measured in human tissues [44] Indeed, [Ala8]NKA(4–10) was shown to be a weak partial agonist ... solvent variation, causing an underestimation of calculated CSDs These CSDHa and CSDCa variations demonstrate the formation of more stable and abundant helical structures for [Aib9]SP than for ... 180°, cannot overlap any conformation of a- amino acids In order to visualize on the potential energy surfaces the conformers of b-amino acids that fit with canonical conformations of a- amino acids,...

Ngày tải lên: 08/03/2014, 08:20

... peptide was recorded by sensorgrams allowing an association time of 300 s and a dissociation of 180 s under a constant flow rate of 20 lLÆmin)1 at 25 °C The sensorgram profile of each run was subtracted ... coating, the HNE peptide was at least partially oxidized and the signal of the reduced species increased as a result of oxidation Identification of the active isoform Because of disulfide scrambling ... bonds stabilizes a conformational epitope of the apical membrane antigen-1 of Plasmodium falciparum [27] Although the sequential epitope of VP1 of foot and mouth disease does not contain intramolecular...

Ngày tải lên: 08/03/2014, 08:20

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from the poly (A) of GT-cDNA2 (data not ... 5¢-RACE and the two alternate 3¢-ends of exon 12 were deduced by 3¢-RACE, and are delineated by the full-length cDNA clones, GT-cDNA1 and GT-cDNA The two putative polyadenylation sites (ATTAAA) are...

Ngày tải lên: 17/03/2014, 03:20

... SDS/PAGE analysis of the purified cellulase from larval gut juice of P hilaris Lane 1, molecular mass standards consisting of myosin (200 kDa), b-galactosidase (116 kDa), phosphorylase B (97.4 kDa), ... Biochim Biophys Acta 1576, 246–254 Da Lage, J.L., Maczkowiak, F & Cariou, M.L (2000) Molecular characterization and evolution of the amylase multigene family of Drosophila ananassae J Mol Evol ... potential proton donor and Analysis of N-terminal amino-acid sequence, cDNA sequence and deduced amino-acid sequence The N-terminal amino-acid sequence of the purified P hilaris cellulase was analyzed...

Ngày tải lên: 17/03/2014, 10:20

... to obtain a reliable retrieval of the imaginary part of ℑµ for ±10% discordance of any of the other mechanical descriptors or of x1 On the other hand, it was shown that a ±10% discordance of the ... times of arrival and thus is fraught with ambiguity, especially when body wave and surface wave times of arrivals are close as at small offsets (Bodet 2005; Foti et al., 2009) or when many surface ... sum of P (for pressure)-polarized and SV (for shear vertical) -polarized plane waves, and b) out -of- (sagittal) plane motion, embodied by a sum of SH (for shear horizontal) -polarized plane waves...

Ngày tải lên: 18/03/2014, 01:21

... Fig 3) (B) Analysis of a standard mixture containing Glc, Gal, Man, Fuc, GlcNAc, GalNAc, ManNAc (C) Analysis of peak (Fig 3A) (D) Analysis of peak (Fig 3A) different chromatographic mobility on ... strain CP N-terminal peptide Monosaccharides were analyzed as AMC derivatives (A) Analysis of a blank sample (eluate fraction between peaks in chromatographic profile shown in Fig 3) (B) Analysis ... demonstrated by fiber X-ray diffraction analysis [33], and, as shown by Falconi et al [31], water hydration sites are mainly located around protein cavities and clefts Raman optical activity spectra also...

Ngày tải lên: 23/03/2014, 13:20

... immediately after dilution or after h of incubation at 30 °C b-T1 behaviour was similar to that of b5 tubulin [33] At early times, the bulk of the radioactivity migrates as a broad band with a slower ... the Materials and methods section and analysed by SDS/ Fig Immunodetection of CCT a- subunit in the cytoplasm of E focardii SDS/PAGE of an E focardii cytoplasmic fraction (20 lg, lane 1) and of ... The amounts of the tubulin bound to CCT were quantitated by the use of a phosphorimager and expressed as a fraction of the maximum amount of bound labeled tubulin and plotted as a function of...

Ngày tải lên: 23/03/2014, 21:20

... strains that lack a capsular structure, which in itself provides serum resistance Recent data from our laboratory indicate that the ability of acapsular strains of H influenzae to elaborate sialylated ... Sialylated LPS in Haemophilus influenzae (Eur J Biochem 269) 4011 Analytical methods and methylation analysis Sugars were determined as their alditol acetates and partially methylated alditol acetate ... potentially of great importance to the virulence of this organism Fig Structural model of the sialylated tetrasaccharide-containing glycoforms of O-deacylated LPS of H influenzae strain RM118 Mutant strains...

Ngày tải lên: 23/03/2014, 21:21