studies on a src family protein

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... towards pNPP at an acidic pH, around 5.5, and Tt SurE was maximally active at pH 8.2 St SurE shows almost no activity in the absence of divalent metal ions Activation by various metal ions was ... Crystal structure and functional analysis of the SurE protein identify a novel phosphatase family Nat Struct Biol 8, 789–794 Zhang RG, Skarina T, Katz JE, Beasley S, Khachatryan A, Vyas S, Arrowsmith...

Ngày tải lên: 18/02/2014, 14:20

10 554 0
Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Some studies on a probabilistic framework for finding object-oriented information in unstructured data

... the 22nd international conference on Machine learning [10] Eric Chu, Akanksha Baid, Ting Chen, An-Hai Doan, and Jeffrey F Naughton A relational approach to incrementally extracting and querying ... solution based on its approach with different advantages, however, they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information ... website usually has its structured information such as location, number of bedrooms, price and area A professor homepage usually contains information about his education, email, department and the...

Ngày tải lên: 23/11/2012, 15:04

51 394 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Serological methods Rabbit antisera against Citrobacter strains PCM 1531 and PCM 1487 were prepared as described previously [21] Passive haemagglutination and inhibition of passive haemagglutination ... lipopolysaccharides in polyacrylamide gels Anal Biochem 119, 115–119 24 Gamian, A. , Romanowska, E & Romanowska, A (1992) Immunochemical studies on sialic acid-containing lipopolysaccharides from ... conclusion was confirmed and the a configuration of ara4dHex established using a NOESY experiment This showed H1,H3 and H1,H5 correlations for Rha at d 4.97/4.06 and 4.97/3.58, which are characteristic...

Ngày tải lên: 23/03/2014, 17:22

7 478 0
Báo cáo toán học: "On a new family of generalized Stirling and Bell numbers" pps

Báo cáo toán học: "On a new family of generalized Stirling and Bell numbers" pps

... connection with normal ordering expressions in the boson annihilation a and creation operator a satisfying the commutation relation aa† − a a = of the Weyl algebra Since the normal ordered form has ... formula, Ramanujan J., to appear [22] M .A Mendez, P Blasiak and K .A Penson, Combinatorial approach to generalized Bell and Stirling numbers and boson normal ordering problem, J Math Phys 46 (2005) Article ... treated in Section 4, where the exponential generating function, the recursion relation and an analogue to Dobinski’s formula are given In Section 5, several combinatorial aspects of the generalized...

Ngày tải lên: 08/08/2014, 14:23

33 322 0
Crystallographic studies on geminin CDT1 complex, proteins involved in DNA replication

Crystallographic studies on geminin CDT1 complex, proteins involved in DNA replication

... symmetry) and a mirror plane An n fold proper rotation operation represents a movement of 2π/n radians around a rotation axis of the object Consider an equilateral triangle This triangle contains a fold ... literature and b unique cells are common in most other languages In the tetragonal, trigonal, and hexagonal systems, one axis contains a higher symmetry axis By convention this axis is selected as the ... the shapes of crystals, characterize and simplify diffraction data collection, and simplify the refinement calculations and presentations of results Mainly, it talks about the internal arrangement...

Ngày tải lên: 04/10/2015, 10:24

99 230 0
Genetic studies on a soil streptomyces sp  that produces an antifungal compoud

Genetic studies on a soil streptomyces sp that produces an antifungal compoud

... can be isolated separately and are designated as type II FAS enzymes In contrast, mammalian FAS are large multifunctional proteins and are designated as type I FAS enzymes Various intermediate ... known as fatty acid synthase (FAS) A 18 LITERATURE REVIEW starter acyl unit, usually acetyl is condensed with a malonyl unit to form a carbon carbon double bond by decarboxylation The starter acetyl ... organic and on synthetic media The variation of colour depends upon many factors, such as the nature and age of the culture Acids and alkalis are known to have a marked effect upon the nature and...

Ngày tải lên: 07/10/2015, 10:02

232 455 0
Indentation studies on a zr based bulk metallic glass

Indentation studies on a zr based bulk metallic glass

... project are described in Chapter 4, including basic material characterizations, conventional hardness measurement by spherical indentation, and nanoindentation characterization around the spherical ... temperature and strain rate, affected the plastic flows in metallic glasses, and that a high strain rate and low temperature (near Tg) condition contributed to non-Newtonian flow Based on the macroscopic ... Indentation Investigation on Metallic Glasses Indentation may introduce a constrained or stable stress field and thus provides a way to characterize multiaxial plastic deformation of BMGs at room...

Ngày tải lên: 09/10/2015, 11:24

119 391 0
Performance Studies on a Downdraft Biomass Gasifier with Blends of Coconut Shell and Rubber Seed Shell as Feedstock

Performance Studies on a Downdraft Biomass Gasifier with Blends of Coconut Shell and Rubber Seed Shell as Feedstock

... equivalence ratio and composition of biomass blends on the performance parameters are evaluated | Paper ID :ICP2015-CP141 Page of 13 a) Species concentration The variations in species concentration ... this gasifier as per supplier specification is wood chip A gas analyser, gas chromatograph and a gas flow meter are provided to measure the quality and quantity of the producer gas Calibrated ... obtained by applying energy balance across zone-2 The linear and non-linear equations are solved using appropriate tools in the open source software SCILAB The equivalence ratio plays a vital...

Ngày tải lên: 29/07/2016, 14:01

14 264 0
Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

Báo cáo khoa học: Epl1, the major secreted protein of Hypocrea atroviridis on glucose, is a member of a strongly conserved protein family comprising plant defense response elicitors potx

... and plate confrontation assays with the plant pathogen R solani at the time points before contact, during contact and after contact of the mycelia and H atroviridis alone on plates (ctrl.) are ... al [23] for growth on various carbon sources and under starvation conditions, and also for plate confrontation assays and the preparation of colloidal chitin and fungal cell walls Osmotic stress ... of Ceratocystis fimbriata f sp Platani FEMS Microbiol Lett 233, 341–346 25 Pazzagli L, Cappugi G, Manao G, Camici G, Santini A & Scala A (1999) Purification, characterization, and amino acid sequence...

Ngày tải lên: 07/03/2014, 12:20

14 494 0
Báo cáo y học: "Proteomics studies confirm the presence of alternative protein isoforms on a large scale" pptx

Báo cáo y học: "Proteomics studies confirm the presence of alternative protein isoforms on a large scale" pptx

... FlyBase, 3,818 from 6-frame translations of miscellaneous functional RNA (rRNA, small nuclear RNA (snRNA) and snoRNA) from FlyBase and 2,594 were generated from the 6frame translation of transcripts ... paper, but we were able to carry out an initial re-analysis against a locally generated database that contained 903,842 peptides from translated transcripts from predicted gene models, translated ... manuscript Additional data files The following additional data are available with the online version of this paper Additional data file lists genes with multiple isoforms detected in the Brunner and...

Ngày tải lên: 14/08/2014, 21:20

10 306 0
Structural studies on DdCAD 1  a ca2+ dependent cell cell adhesion protein

Structural studies on DdCAD 1 a ca2+ dependent cell cell adhesion protein

... TGGAATGATAAATTCATGTCATGTTTGGTTGGTTCAAATGTTAGATGTAACATT W N D K F M S C L V G S N V R C N I 162 54 TGGGAGCATAATGAAATTGATACTCCAACTCCAGGAAAATTCCAAGAATTGGCT W E H N E I D T P T P G K F Q E L A 216 72 CAAGGCAGTACAAACAATGATTTAACCTCAATAAATGGTCTTTCAAAGTTCCAA ... ATGTCTGTTGATGCAAATAAAGTAAAATTCTTCTTTGGTAAAAACTGCACTGGT M S V D A N K V K F F F G K N C T G 54 18 GAATCATTTGAATACAACAAAGGTGAAACTGTAAGATTCAACAATGGTGATAAA E S F E Y N K G E T V R F N N G D K 108 36 TGGAATGATAAATTCATGTCATGTTTGGTTGGTTCAAATGTTAGATGTAACATT ... P T T G 540 180 CAAGTTACAGTTATTAAAAAAGATGAGACATTCCCAAAGAATATGACTGTTACA Q V T V I K K D E T F P K N M T V T 594 198 CAAGATGATAATACATCTTTCATCTTTAACTTAAACTCTGAAAAATAA Q D D N T S F I F N L N S E...

Ngày tải lên: 15/09/2015, 17:10

216 97 0
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

... compilation ª 2008 FEBS Md S Alam et al 39 Nakamura H, Nakamura K & Yodoi J (1997) Redox regulation of cellular activation Annu Rev Immunol 15, 351–369 40 Nishinaka Y, Masutani H, Nakamura H & ... chelation by EDTA was studied by measuring absorption at 420 nm In parallel, samples without EDTA (as a control) were also incubated similarly and A4 20 was measured To exclude the effect of air ... conditions [1] Among several mechanisms for resistance to intracellular killing, the scavenging of free radicals and the reactivation of degenerated proteins during infection by a family of proteins...

Ngày tải lên: 18/02/2014, 12:20

18 548 0
Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

... fragment ions, and then reacting them with a second anion that functions as a base rather than an electron donor The carboxylate anion of benzoic acid satisfies this requirement and deprotonates ... limitations [3] For ETD, radical anions of polyaromatic hydrocarbons, such as fluoranthene, are formed under chemical ionization conditions, stored in a quadrupole linear ion trap (QLT) mass spectrometer, ... resulting radical anion abstracts a proton and generates a radical site that triggers dissociation to produce a complementary pair of fragment ions of type c¢ and z¢Æ Subtraction of the m ⁄ z values...

Ngày tải lên: 18/02/2014, 16:20

8 579 0
Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx

Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx

... 3¢-GTCACAGAGCCACAGTTCCAG CCAGGA-5¢ Codon 305 of C-YES was mutated from AAA (Lys) to AGA (Arg) with the forward primer: 3¢-GG AACCACGAAAGTAGCAATCAGAACACTAAAACCA GGTACAATGATGC-5¢ All vector inserts ... C-YES and C -SRC were assayed for Y17 kinase activity using the plate format assay at various concentrations of the Src family kinase inhibitor PP2 Values are the average of four samples normalized ... brilliant blue G (Sigma-Aldrich) and a sample from the 60 kDa band was excised The sample was analysed using Q-TRAP MS by the Protein Analysis Laboratory at the Cancer Research UK London Research...

Ngày tải lên: 18/02/2014, 18:20

11 457 0
Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

Tài liệu Báo cáo khoa học: Specific membrane binding of the carboxypeptidase Y inhibitor IC, a phosphatidylethanolamine-binding protein family member doc

... Kinetic parameters, the association rate constant ka, and the dissociation rate constant kd, were determined by the global fitting of the sensorgrams to a : Langmuir binding model using biaevaluation ... Japan) equipped with U-MNIBA2 and U-MWIG2 mirror units (Olympus), a digital charge-coupled device camera C4742-95–12ER (Hamamatsu Photonics, Hamamatsu, Japan), and aquacosmos 2.0 software (Hamamatsu ... 1962–1965 Abe M, Kobayashi Y, Yamamoto S, Daimon Y, Yamaguchi A, Ikeda Y, Ichinoki H, Notaguchi M, Goto K & Araki T (2005) FD, a bZIP protein mediating signals from the floral pathway integrator FT at...

Ngày tải lên: 19/02/2014, 05:20

10 646 1
Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

Tài liệu Báo cáo khoa học: Inhibitory effects of nontoxic protein volvatoxin A1 on pore-forming cardiotoxic protein volvatoxin A2 by interaction with amphipathic a-helix doc

... supplementary Table S1 Poly (A+ ) RNA was isolated from the total RNA fraction on an oligo (dT)-cellulose column, and poly (A+ )-rich mRNA was reverse-transcribed with a Marathon cDNA amplification kit ... Biolabs Inc (Beverly, MA) The Marathon cDNA amplification kit was from Clontech (Palo Alto, CA) Fluorescent Alexa-568-labeled goat anti-rabbit and fluorescein isothiocyanate (FITC) were purchased ... incubated with increasing amounts of VVA2, and visualization on an SDS ⁄ PAGE gel showed that the adsorbed VVA2 had oligomerized As the amount of VVA2 in the reaction was increased, more VVA2 was...

Ngày tải lên: 19/02/2014, 06:20

12 585 0
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx

... da Silva JJR, Amorim MTS, Cabral MF, Chaves S & Costa J (1991) Dissociation constants of Bronsted acids in D2O and H2O: studies on polyaza and polyoxa–polyaza macrocycles and a general correlation ... oxidized haem causes a paramagnetic shift on its 2258 C A Salgueiro et al signals that is directly proportional to the fractional oxidation in the absence of extrinsic paramagnetic contributions As ... solution at pH 7.0: indigo tetrasulfonate, indigo trisulfonate, indigo disulfonate, anthraquinone-2-7-disulfonate, anthraquinone2-sulfonate, safranine O, diquat, neutral red, phenosafranine, and methylviologen,...

Ngày tải lên: 19/02/2014, 17:20

10 640 0
Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

Báo cáo khoa học: Studies on the role of the receptor protein motifs possibly involved in electrostatic interactions on the dopamine D1 and D2 receptor oligomerization pdf

... D2R1 (217AARRKR222) mutant displayed half of the Bmax value obtained for D2R, whereas the density of the D2R2 (217AAAAKR222) mutant was much lower (Fig 1B) For the D2R3 (217AAAAAA222) variant, no ... assays were performed in a total volume of 500 lL Saturation studies were carried out on a fresh membrane preparation (final protein concentration of 20 and 40 lgÆtube)1 for the D1 and D2 dopamine ... or more adjacent glutamate or aspartate residues, and ⁄ or a phosphorylated residue, on the other protein [41,42] Ciruela et al demonstrated that electrostatic interactions between an arginine-rich...

Ngày tải lên: 07/03/2014, 03:20

16 567 0
Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

Báo cáo khoa học: Studies on structure–function relationships of indolepyruvate decarboxylase from Enterobacter cloacae, a key enzyme of the indole acetic acid pathway ppt

... used as molecular mass standards Small angle X-ray solution scattering with synchrotron radiation Data were collected on the X33 camera of the European Molecular Biology Laboratory outstation at ... optical assay was elaborated with alcohol dehydrogenase as auxiliary enzyme, catalysing the aldehyde–alcohol conversion similar to the assays established for pyruvate decarboxylase (PDC) and benzoylformate ... the addition of 0.2 M ammonium sulphate (inactivation rate constant 10)6 s)1 at 40 °C) or cofactors ThDP and Mg2+ Koga et al [7] also described an effective stabilization of EcIPDC after addition...

Ngày tải lên: 08/03/2014, 02:20

10 430 0
Báo cáo khoa học: Fully active QAE isoform confers thermal hysteresis activity on a defective SP isoform of type III antifreeze protein docx

Báo cáo khoa học: Fully active QAE isoform confers thermal hysteresis activity on a defective SP isoform of type III antifreeze protein docx

... successive stacking of hexagonal ice plates on the basal plane, leading to the formation of an ice bipyramid, as illustrated in Fig When pyramidal planes are created by the adsorption of AFPs, the ... retention of the c- : a- axis ratio at approximately 3.3 for flounder type I AFP mutants that accumulate onto a {20  21} pyramidal plane Significantly, a similar continuous growth of the ice bipyramid ... first basal plane [14], thereby creating a hexagonal ice plate that is smaller than the first layer Repeated binding of AFP to the prism plane and the generation of a smaller ice nucleus cause successive...

Ngày tải lên: 16/03/2014, 04:20

9 289 0
w