studies of the basic pharmacokinetic properties of a drug—a regulatory perspective
Báo cáo khoa học: Conformational studies of a hyperthermostable enzyme potx
Ngày tải lên :
07/03/2014, 21:20
... and rotational motion of the protein [6,7] Even in the absence of structural data, valuable information about the local and global dynamics of LamA can be inferred from inspection of the fluorescence ... from all emitting groups Nevertheless, valuable information can be obtained from analyses of the conformational states of LamA upon heat treatment and in the presence of GdnHCl At the experimental ... is advantageous for the calculation of the rotational diffusion of a protein in solution The rotational properties depend on the orientation of the dipoles relative to the main symmetry axis and,...
- 13
- 283
- 0
Báo cáo khoa học: Atrial natriuretic peptide-dependent photolabeling of a regulatory ATP-binding site on the natriuretic peptide receptor-A pptx
Ngày tải lên :
16/03/2014, 23:20
... oligonucleotides 5¢-TGAGCAACTCAAGAGA GGTGAAAGAGGCTCTTCTACACGTGGTTAAGGTA C-3¢ and 5¢-CTTAACCACGTGTAGAAGAGCCTCTTT CACCTCTCTTGAGTTGC-3¢) was ligated to complete the construction up to amino acid R833 of wild ... activation of membrane-bound guanylate cyclase by the atrial natriuretic factor FEBS Lett 219, 375–379 21 Marala RB, Sitaramayya A & Sharma RK (1991) Dual regulation of atrial natriuretic factor-dependent ... in the membrane preparation, as measured using a gamma counter Membrane preparations were then used in guanylyl cyclase assays A total of lg of membranes was incubated for 12 at 37 °C in the...
- 12
- 338
- 0
Báo cáo khoa học: Crystal structure determination and inhibition studies of a novel xylanase and a-amylase inhibitor protein (XAIP) from Scadoxus multiflorus pot
Ngày tải lên :
29/03/2014, 09:20
... inhibits the activity of a- amylase in a : 1.2 molar ratio The inhibition of a- amylase by XAIP was also observed in the presence of GH11 xylanase Thus, the inhibition of a- amylase by XAIP is unaffected ... observations indicate that XAIP associates with GH11 xylanase and GH13 a- amylase, as well as with both xylanase and a- amylase simultaneously Tissue distribution of XAIP The output of SDS–PAGE for the ... cleft of a- amylase There are at least 12 hydrogen bonds and ˚ several van der Waals’ contacts (£ 4.0 A) between the two molecules There are at least six common residues of a- amylase that participate...
- 15
- 399
- 0
Assessment of weed management practices and problem weeds in the midsouth united states—soybean a consultants perspective
Ngày tải lên :
04/09/2015, 08:07
... Palmer amaranth The area where Palmer amaranth was hand-weeded in 2011 was 3.5 and 15% of the total area scouted in Louisiana and the remaining midsouth, respectively (Table 6) On average, hand-weeding ... problematic weeds of Arkansase Palmer amaranth Amaranthus palmeri S Wats Morningglory Ipomoea spp Barnyardgrass Echinochloa crus-galli (L.) Beauv Horseweed Conyza canadensis (L.) Hemp sesbania Sesbania ... Urochloa platyphylla (Nash) R.D Webster Oryza sativa L Amaranthus rudis Sauer Digitaria spp Lamium amplexicaule L Physalis spp Brachiaria ramosa (L.) Stapf Commelina diffusa Burm f Cucurbita pepo...
- 12
- 556
- 0
Functional studies of a type III and a novel secretion system of edwardsiella tarda
Ngày tải lên :
15/09/2015, 17:11
... such as Escherichia coli, Salmonella, Shigella, and Yersinia species E tarda is a relatively new genus, and the first report about the genus of Edwardsiella was in Japan by Sakazaki and Murata (1962) ... decrease Furthermore, the adherence and invasion rates of esrA and esrB mutants were enhanced while those of the apparatus and chaperone mutants remained similar to that of the wild type (Tan et al., ... types of catalaseperoxidase (Kat1-3) of which KatB being the major catalase enzyme (Srinivasa Rao et al., 2003b) KatB was required for E tarda survival and replication in phagocyte-rich organs...
- 205
- 618
- 0
The development of shang in the past five hundred years a corpus perspective
Ngày tải lên :
12/10/2015, 17:36
... new classification is that shang could be analyzed as a whole, and the data of shang will reveal the developmental trend of shang The new classification is listed as follows: THE NEW SHANG CLASSIFICATION ... meaning In these shang-phrases, the place of the object which causes the act and the place of the object which receives the act are changed and the place where the act ends will be the destination.” ... from all nine Chinese novels, and calculate 19 the quantity of these shang-phrases in them because statistical data may reveal the pattern of change 2.1.2 SHANG IN TYPE A2 Type A2 : shang...
- 81
- 216
- 0
RETHINKING THE PALEOPROTEROZOIC GREAT OXIDATION EVENT: A BIOLOGICAL PERSPECTIVE pdf
Ngày tải lên :
30/03/2014, 16:20
... between the widespread radiation of cyanobacteria and the first accumulation of small amounts of free O2 on a global scale, as well as the lethal effects on many Archean organisms of the O2 produced ... primarily because of a methanogen population crash in the surface ocean at the same time there was an expansion of the aerobic methanotroph population due to the increasingly oxygenated state of ... production during the Archean because the total continental area and shallow coastal habitat were much smaller than they are now (approximately 5% of the present Precambrian continental crust existed...
- 27
- 394
- 0
Báo cáo sinh học : "The genomic ‘inner fish’ and a regulatory enigma in the vertebrates." docx
Ngày tải lên :
06/08/2014, 19:20
... in wings and thermal homeostasis in both mammals and birds, the vast bulk of comparative anatomy data reveals the deep roots of tissues and organ systems Morphology indicates that the basic sensory, ... substantial fraction of those genes are expressed in a given cell type, then there may be many ways to achieve the same transcriptional output In these circumstances, a rather fluid exchange of regulatory ... important, these datasets are harbingers of the more quantitative and qualitative comprehensive description of morphology, a more theoretically grounded understanding of evolutionary processes that...
- 4
- 265
- 0
Báo cáo y học: "Chondroitin and glucosamine sulfate in combination decrease the pro-resorptive properties of human osteoarthritis subchondral bone osteoblasts: a basic science study" pptx
Ngày tải lên :
09/08/2014, 10:21
... participated in acquisition, analysis, and interpretation of data HF and ML participated in acquisition of data J-PP participated in analysis and interpretation of data and manuscript preparation ... preparation, and statistical analysis SKT participated in study design, acquisition of data, analysis and interpretation of data, manuscript preparation, and statistical analysis JV and EM participated ... presence of vitamin D3 at 50 nM Total RNA was extracted and processed for quantitative polymerase chain reaction (qPCR), and the data are expressed as the mean ± standard error of the mean of arbitrary...
- 10
- 599
- 1
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
Ngày tải lên :
17/02/2014, 22:20
... metropolitan areas complained of narrowness of their houses in the 1960 s At the time, airtight houses started to be built in urban area, and air pollution due to a lack of fresh air because of the ... (in Japanese) IPCS (1989) Environmental Health Criteria 89 Formaldehyde, World Health Organization, Geneva Takeda, M., Saijo, Y., Yuasa, M., Kanazawa, A. , Araki, A and Kishi, R (2009) Relationship ... Indoor Air Quality Indoor Environ., 1, 27–34 (in Japanese) 126) Kishi, R., Saijo, Y., Kanazawa, A. , Tanaka, M., Yoshimura, T., Chikara, H., Takigawa, T., Morimoto, K., Nakayama, K and Shibata, E (2009)...
- 14
- 940
- 1
Tài liệu Báo cáo khoa học: Binding of ligands originates small perturbations on the microscopic thermodynamic properties of a multicentre redox protein pptx
Ngày tải lên :
19/02/2014, 17:20
... optimization The half-height widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the ... because these are the most distant pair of haems in the structure and are therefore expected to have the weakest interaction [33] The pH dependence of the chemical shifts of the NMR signals of the ... that the spectra are very similar with respect to chemical shifts of the signals in intermediate stages of oxidation, and that formation of the complex does not lead to a marked decrease of the...
- 10
- 640
- 0
Tài liệu Báo cáo Y học: Antibacterial and antifungal properties of a-helical, cationic peptides in the venom of scorpions from southern Africa pptx
Ngày tải lên :
21/02/2014, 15:20
... more antibacterial than dermaseptin (34 amino acids) [19], peptides consisting of amino acids 7–22 of parabutoporin (an a- helical part having the four amino acids LAKK identical to mastoparan) and ... mastoparan gave the same results The role of LPS in the interaction was also demonstrated by the lack of effect of extracellular Mg2+ on the activity of the peptides against Gram-positive bacteria ... has generally been related to their antibacterial activity [20], parabutoporin and opistoporin were tested on Gramnegative and Gram-positive bacteria and their activity was compared with the activity...
- 12
- 598
- 0
Báo cáo khoa học: Reduction of a biochemical model with preservation of its basic dynamic properties doc
Ngày tải lên :
07/03/2014, 11:20
... + NAD+ fi BPG + NADH BPG + ADP fi ACA + ATP ACA + NADH fi NAD+ ATP fi ADP Glc + ATP fi ADP trioseP + NADH fi NAD+ ACA Ð ACA x ACAx fi GAPDH: lowpart: ADH: ATPase: storage: glycerol: difACA: outACA: ... indicated in Table All the underlying parameter values are the same as in the 20D model, i.e no parameter optimization was done in the elimination of variables approach The model’s parameters are ... several ways For example, the quasi steady-state approximation can be applied for each of the eliminated variables, or they can simply be fixed at their steady-state values In this study we want the...
- 16
- 492
- 0
Báo cáo khoa học: Dissociation/association properties of a dodecameric cyclomaltodextrinase Effects of pH and salt concentration on the oligomeric state pot
Ngày tải lên :
07/03/2014, 12:20
... 5Â-AGTACATGTGGGACGTCAC CATGGAGTATGTCCC-3Â (forward) and 5Â-GGGACAT ACTC CATGGTGACGTCCCACATGTACT-3Â (reverse); for the H89V mutant, 5Â-TCTGCTGCAGCA GGGTGTT GAGAAGCGCTGGATG-3Â (forward) and 5Â-CATCCAG CGCTTCTCAACACCCT ... of change in the peak area shown in Fig 3A was estimated according to an equation of single exponential decay [7], peak areaịt ẳ Aekt ỵ B: From the equation above, the slope of the exponential ... obtained about the 3D structure of CDase I-5, the quaternary state of CDase I-5 was likely to be maintained by the intrinsic capability of the N- and C-terminal regions of the enzyme to form a...
- 13
- 511
- 0
Báo cáo khoa học: NMR and molecular dynamics studies of an autoimmune myelin basic protein peptide and its antagonist Structural implications for the MHC II (I-Au)–peptide complex from docking calculations ppt
Ngày tải lên :
07/03/2014, 16:20
... chain of Arg78 is almost always less than A from a negatively charged group, mainly Asp81 and Glu82, but also the COO– terminal of Val85 This is definitely not the case for the antagonist, as Arg78 ... the case of the agonist, which makes it somewhat more accessible than the antagonist, as suggested by the solvent-accessible surface area These data clearly demonstrate the structural importance ... distant from the side chain of Arg78 The side chain of Arg78 is less well defined, as in the case of aqueous solution, because of the absence of interactions with the side chains of Asp81 (in the...
- 15
- 447
- 0
Báo cáo Y học: Functional studies of the Synechocystis phycobilisomes organization by high performance liquid chromatography on line with a mass spectrometer docx
Ngày tải lên :
08/03/2014, 16:20
... eluting at 18 (labeled by arrows) and showing a molecular mass of 34 316 Moreover, sucrose gradient analysis of the treated cyanobacteria showed the disappearance of the heaviest sucrose band (inset ... disappearance of the b-phycocyanin already after h of illumination (Fig 4) In contrast, SDS/PAGE analysis of the total mixture of phycobilisomes exposed to the same UV-B irradiation did not reveal any ... allowed a quantitative estimation of the relative amount of each protein component from the area underlying each peak This was facilitated by the fact that the biliproteins are strongly conserved and...
- 9
- 477
- 0
Báo cáo khóa học: Functional properties of the protein disulfide oxidoreductase from the archaeon Pyrococcus furiosus A member of a novel protein family related to protein disulfide-isomerase doc
Ngày tải lên :
16/03/2014, 16:20
... tokodaii; Ap, Aeropyrum pernix; Ta, Thermoplasma acidophilum; Tv, Thermoplasma volcanium; Fa, Ferroplasma acidarmanus; Tm, Thermotoga maritima; Aa, Aquifex aeolicus; Tt, Thermoanaerobacter tengcongensis ... K., Takahashi, M., Sekine, M., Baba, S., Ankai, A. , Kosugi, H., Hosoyama, A. , Fukui, S., Nagai, Y., Nishijima, K., Otsuka, R., Nakazawa, H., Takamiya, M., Kato, Y., Yoshizawa, T., Tanaka, T., ... sequence of Thermoplasma volcanium Proc Natl Acad Sci USA 97, 14257–14262 49 Kawarabayasi, Y., Hino, Y., Horikawa, H., Yamazaki, S., Haikawa, Y., Jin-n., o, K., Takahashi, M., Sekine, M., Baba, S., Ankai,...
- 12
- 506
- 0
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
Ngày tải lên :
17/03/2014, 09:20
... cofactor onto the structure of the ligandfree rPAH (containing the regulatory and catalytic domains) [19] revealed that both the reduced and the oxidized cofactor interact with the N-terminal ... dopamine binary complex [17] was superimposed onto that of the ligand-free rPAH containing the regulatory and catalytic domains [19] the catecholamine main-chain is also ể FEBS 2003 Regulatory properties ... Cardiovascular Diseases We greatly appreciate the expert technical assistance of Ali Sepulveda Munoz in expression and purication of the recombinant enzymes, and the sta of the Swiss-Norwegian Beamlines...
- 10
- 470
- 0
