studies of collagen crosslinking in cartilage fibrils
Aptitude for Destruction, Volume 2 - Case Studies of Organizational Learning in Five Terrorist Groups pptx
Ngày tải lên :
22/03/2014, 23:20
... sustained changes that involve intentional action by or within a group at some point—such as one or more of the following: intentional seeking of new knowledge or new ways or doing things; intentional ... clothes to indicate their levels of religious attainment Members could rise through the ranks of the organization by paying initiation fees to participate in certain levels of training To join the ... commercially and another informal in the form of repeated experimentation The few instances of formal training focused on specialized expertise in how to operate things The informal training focused on...
- 216
- 307
- 0
Báo cáo khoa học: P NMR studies of energy metabolism in xanthosine5¢-monophosphate overproducing Corynebacterium ammoniagenes pot
Ngày tải lên :
23/03/2014, 17:22
... growing medium were optimized to gain maximum XMP production (Table 1) As shown in Table 1, an increase in the glu/glc ratio (glu/glc) induced a significant increase in XMP production, and this increase ... switch in the carbon flux In Table 1, glu increased the XMP/Hyp ratio, being dependent on the increased level of glu/glc ratio up to 0.46, which mainly resulted from the extension of the length of ... in XMP production was coupled with a reduction in production of the by-product, hypoxanthine XMP production attained nearly plateau levels at a glu/glc molar ratio of 0.31 Further increases in...
- 5
- 304
- 0
Báo cáo vật lý: "Volumetric and Thermodynamic Studies of Molecular Interactions in Ternary Liquid Mixtures at 303, 308 and 313K" pptx
Ngày tải lên :
07/08/2014, 14:20
... value of viscosity increased with increasing concentrations of 1alkanols and decreased with increasing temperature As the number of hydrocarbon groups or the chain-length of the alcohol increased, ... that in the case of liquid systems, including electrolytic solutions, there is no serious harm in assuming cubic packing and equating b to 3.3 Gibb’s Free Energy (ΔG*) On the basis of Eyring rate ... variation in excess free volume as a function of the concentration of 1-alkanols in all systems The values of excess free volume were almost positive in all of the systems and decreased with increasing...
- 13
- 258
- 0
Báo cáo y học: "Potential involvement of oxidative stress in cartilage senescence and development of osteoarthritis: oxidative stress induces chondrocyte telomere instability and downregulation of chondrocyte function" pptx
Ngày tải lên :
09/08/2014, 06:22
... GAG in cartilage were analyzed by determining the GAG content remaining in cartilage tissue relative to the total amount of GAG in the culture (GAG released into the culture media plus GAG in ... to the articular cartilage matrix, we examined the amount of GAG remaining in cartilage tissue and that was released into the culture medium in organ culture in the presence of an antioxidative ... antioxidative agent in tissue culture abolic change in articular cartilage matrix was analyzed by determining the GAG content remaining in the cartilage extract relative to the total amount of GAG in the...
- 12
- 407
- 0
Báo cáo y học: "Systematic review and meta-analysis of randomised trials and cohort studies of mycophenolate mofetil in lupus nephritis" pdf
Ngày tải lên :
09/08/2014, 08:23
... original authors (mainly urine protein excretion, serum creatinine or creatinine clearance, or a combination of these) and subsequent relapse Adverse events sought included mortality, infection (especially ... residual bias in observational studies and lack of blinding in randomised trials The amount of information for MMF is greater than for cyclophosphamide and azathioprine in this indication, and ... evaluation of homogeneity tests in meta-analyses in pain using simulations of individual patient data Pain 2000, 85:415-424 33 L'Abbe KA, Detsky AS, O'Rourke K: Meta-analysis in clinical research Ann Intern...
- 10
- 433
- 0
Báo cáo khoa học: "Clinical review: The implications of experimental and clinical studies of recruitment maneuvers in acute lung injury" pptx
Ngày tải lên :
12/08/2014, 19:22
... volumes Those investigators showed that, after RMs, PEEP set at cmH2O above the lower inflection point was more effective in maintaining gas exchange and minimizing inflammation and lung injury than ... lower inflection point before a sustained inflation Loop B: tidal insuflation with a PEEP below the lower inflection point after a sustained inflation Loop C: PEEP higher than the lower inflection ... severely injures lungs does not lead to release of significant amounts of inflammatory cytokines by the lung in the absence of lipopolysaccharide challenge Likewise, in experimental studies other investigators...
- 7
- 287
- 0
MOLECULAR AND PHYSIOLOGICAL STUDIES OF SALT TOLERANCE IN THE SALT SECRETOR MANGROVE AVICENNIA OFFICINALIS
Ngày tải lên :
09/09/2015, 08:13
... Determination of salt gland density in A officinalis leaves 67 Figure 3.4: Salt gland structure from A officinalis leaves 69 Figure 3.5: Estimation of ions in xylem sap of A officinalis ... Quantification of hormones in leaves of two-month-old A officinalis seedlings up on salt treatment 77 Figure 3.9: Quantification of hormones in roots of two-month-old A officinalis seedlings ... CCATTAGGTGGCCAGCTCTC 24 Annotation Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers qRT-PCR primers Cloning Cloning Cloning Cloning qRT-PCR primers...
- 218
- 765
- 0
Ion channeling studies of defect formation in gan and related materials
Ngày tải lên :
16/09/2015, 08:31
... surprising success After this, interest in GaN research grew rapidly as clear in Fig 1.1 and interest is being maintained due to essential position of GaN and its alloys in solid state lighting ... backscattering similar to surface increasing χmin The dechannelling factor σD in case of stacking fault is given by, σD = χmin (4.18) Additional monolayer Figure 4.4: A schematic of a stacking fault ... materials in making devices introduces defects The control of these defects is very important Ion channelling can be used to look into the introduction and removal of defects during materials processing...
- 124
- 442
- 0
High-Surface-Area Catalyst Design- Synthesis, Characterization, and Reaction Studies of Platinum Nanoparticles in Mesoporous SBA-15 Silica
Ngày tải lên :
08/10/2015, 23:16
... The slope of the line (not shown) at both temperatures is ∼1 verifying that the measured rate is independent of the influence of transport effects Table also contains a compilation of apparent ... The minimal change in SBA-15 physical parameters after incorporation of Pt into the silica reveals that there is no significant blocking of the SBA-15 channel by Pt particles 3.2.2 Efficient Incorporation ... explain the structure insensitivity of olefin hydrogenation reactions.44,66 The presence of this organic layer on the metal surface effectively washes out the original metal surface In the case, of...
- 11
- 471
- 0
Optical and electrical studies of silicon nanowires in photovoltaic applications
Ngày tải lên :
12/10/2015, 17:35
... possibility of integrating MEG into the carrier generation mechanism of SiNW PV devices It aims at fabricating an array of ultra-thin SiNWs in which MEG phenomenon could be detected In Chapter ... data of SiNW surface and planar Si surface, measured using integrating sphere (b) Reflected spectral irradiance of SiNW surface comparing with that of planar Si surface; the inset shows incident ... highlighting the advantages and promising prospect of SiNWs in the design and fabrication of third generation solar cells In previous works, SiNWs were fabricated using a variety of methods, which mainly...
- 92
- 396
- 0
Pharmacokinetic and pharmacodynamic studies of mycophenolic acid in renal transplant recipients
Ngày tải lên :
28/11/2015, 13:44
... concentration-time profile of total MPA in patients for conventional study following chronic oral dosing of MMF after fitting in two compartment model 117 Plasma concentration-time profile of free MPA in patients ... target of rapamycin Mammalian target of rapamycin Molecular weight cutoff Mizoribine Nicotinamide adenine dinucleotide Other race Every morning One compartment model Phosphate Buffer Saline Pharmacodynamic ... drug regimen of a calcineurin inhibitor cyclosporine A (CsA), prednisolone and azathioprine A calcineurin inhibitor tacrolimus (TAC), a mTOR 10 (mammalian target of rapamycin) inhibitor Sirolimus...
- 207
- 246
- 0
báo cáo hóa học:" Study of the collagen structure in the superficial zone and physiological state of articular cartilage using a 3D confocal imaging technique" pptx
Ngày tải lên :
20/06/2014, 01:20
... (unloading region).(B) A 3D image of the lamina splendens shows the collagen network within it is compromised of unique interwoven collagen bundles (ICB) (C) The corresponding MBI of the collagen ... not clinical applicable, our current study on the investigation of clinical viable staining techniques for imaging the collagen and other micro-components of AC in vivo shows the potential of developing ... wear of the AC, and consequently reduction of the loading capacity of AC as a result of progressive release of proteoglycans from the cartilage [22] Therefore, study of the 3D collagen network in...
- 11
- 475
- 0
Báo cáo y học: "Early and stable upregulation of collagen type II, collagen type I and YKL40 expression levels in cartilage during early experimental osteoarthritis occurs independent of joint location and histological grading" ppt
Ngày tải lên :
09/08/2014, 06:22
... analysis of the response of articular cartilage to increased joint instability and altered mechanical loading, and thus to gain more insight into the very early stages of mechanically induced cartilage ... and of YKL40 in knee cartilage, which is independent of the time lapse since surgery, of the particular joint region studied and of the structural appearance of the extracellular matrix in adjacent ... Knee instability is very likely to increase inappropriate mechanical loading in many parts of the joint and, in keeping with this, col II and YKL40 expression rose in all locations after ACLT in...
- 10
- 362
- 0
Báo cáo y học: "Inhibition of hyaluronan export reduces collagen degradation in interleukin-1 treated cartilage" pot
Ngày tải lên :
09/08/2014, 10:22
... cultured in alginate beads and incubated in culture medium containing [14C]proline in the absence and presence of zaprinast and incorporation of radioactivity into pepsin-resistant collagen was ... account Figure Inhibition of protein infiltration into bovine cartilage explants Cartilage explants explants were incubated in the absence or presence of IL-1α and (a) tadalafil, (b) zaprinast, or ... incubated with increasing concentrations of the inhibitors in the presence of [35S]sulphate After 24 hours the radioactivity incorporated into [35S]proteoglycans was determined Inhibition of proteoglycan...
- 9
- 353
- 0
Nanofabrication, architecture control, and crosslinking of collagen scaffolds and the potential in corneal tissue engineering application
Ngày tải lên :
14/09/2015, 09:33
... NANOFABRICATION, ARCHITECTURE CONTROL, AND CROSSLINKING OF COLLAGEN SCAFFOLDS AND THE POTENTIAL IN CORNEAL TISSUE ENGINEERING APPLICATION ZHONG SHAOPING (M.ENG INSTITUTE OF PROCESS ENGINEERING, ... engineering 31 2.5 The potential of electrospinning in corneal scaffolding 40 Chapter Non-aqueous crosslinking of electrospun collagen nanofibers: the effects on physical properties of ... fibers, fibrils, and molecules, (a) primary amino acid sequence of collagen chain, (b)AFM micrograph of collagen (left) and schematic diagram of collagen fibrils (right), (c) TEM micrograph of collagen...
- 187
- 329
- 0
Báo cáo y học: "Translational Medicine and Reliability of Single-Nucleotide Polymorphism Studies: Can We Believe in SNP Reports or Not"
Ngày tải lên :
25/10/2012, 10:51
... difference in the proportions of positive and negative studies analysing a determined polymorphisms between the studies examining it within 1-3 polymorphisms versus studies examining the same ... available to orient them in a correct interpretation of potential misleading sources of literature-bias The existence of such type of bias in genetic association studies might lead to incorrect 497 conclusions ... cancer risk, studies that included patients with hematologic malignancies and studies that investigated the role of GST polymorphisms on pharmacokinetics of specific drugs Two investigators independently...
- 9
- 524
- 0
Tài liệu SURVEY OF CASE STUDIES OF THE USE OF KNOWLEDGE MANAGEMENT IN SOFTWARE ENGINEERING docx
Ngày tải lên :
16/01/2014, 16:33
... organizational learning: Representing and maintaining knowledge in an experience base, in Proc Tenth Int Conf on Software Engineering and Knowledge Engineering, SEKE98, 1998 44 T Dingsứyr, A lifecycle ... methods according to the subject of study; in software engineering it can be either a process to produce software or a software product In an article on research methods in software engineering [30] ... years of conferences like the International Conference on Software Engineering, The Software Engineering and Knowledge Engineering Conference, the International Conference on Product Focused Software...
- 24
- 705
- 0
Tài liệu A REVIEW OF INDOOR AIR POLLUTION AND HEALTH PROBLEMS FROM THE VIEWPOINT OF ENVIRONMENTAL HYGIENE: FOCUSING ON THE STUDIES OF INDOOR AIR ENVIRONMENT IN JAPAN COMPARED TO THOSE OF FOREIGN COUNTRIES pptx
Ngày tải lên :
17/02/2014, 22:20
... phthalates were detected predominantly in indoor air samples.93) The dominant path of phthalates intake was the ingestion of foodstuffs compared to inhalation of indoor air by children.94) n-Tetradecane ... can meet local needs in dealing with SHS.152) CONCLUSION Healthy indoor air is a fundamental right for people studying in schools, working in of ces and living in residences Indoor air quality ... combustion gases in residences and buildings CO is well-known to cause poisoning by CO-hemoglobin (Hb) formation, inhibiting oxygen utilization by internal organs NO2 sources in buildings include gas...
- 14
- 940
- 1
Tài liệu Báo cáo khoa học: "From HOPE en I''''ESPERANCE On the Role of Computational Neurolinguistics in Cross-Language Studies " pptx
Ngày tải lên :
21/02/2014, 20:20
... results Because of the parallel activation of a l l meanings of each recognized word in HOPE, the determination of the phonetic representation of a recognized word determines the breadth of active ... often generic and mark masculine, feminine, or plural (Gross, 1977; Goffic and McBride, 1975) And furthermore, these same articles often are not translated into meaning preserving sentences in ... appropriate masculine/feminine indicators (Jayez, 1982) The issues are not whether human brains work in a universal fashion, but instead raise questions of how interpreted levels of representation,...
- 5
- 609
- 0
Tài liệu Euphorion Being Studies of the Antique and the Mediaeval in the Renaissance - Vol. II pot
Ngày tải lên :
21/02/2014, 21:20
... self-sufficing art of painting Selection, therefore, which is the only practical kind of idealism, had begun as soon as painting was possessed of the power of representing objects in their relations of ... finding every moment something new, some charming piece of gilding, some sweet plumed head, some quaint little tree or town; making a journey of lazy discovery in a sort of world of Prince Charmings, ... ever in the dazzling, vague sheen of the Eternal Feminine Hence, one of the most distinctive features of mediổval love, an extraordinary sameness of intonation, making it difficult to distinguish...
- 71
- 630
- 0