structure including dom events in a single chain

... al.: Triple malignancy in a single patient including a cervical carcinoma, a basal cell carcinoma of the skin and a neuroendocrine carcinoma from an unknown primary site: A case report and review ... reported a case of four malignancies in the same patient including a cervical carcinoma and a basal cell carcinoma but in a metachronous setting [6] Human papilloma virus (HPV) infection has a wellestablished ... the analysis of the data HE approved the treatment and analyzed the literature data All authors read and approved the final manuscript Competing interests The authors declare that they have no...

Ngày tải lên: 10/08/2014, 23:20

... once a week or two weeks from June to December 13 in 2000, the average T-BOD concentration at Ekiminami of Saina River was as high as 10mg/L In addition, the average T-BOD loading at the same point ... Fujiwara T., Ohtoshi K., Ishikawa R and Ikebe M (2002) Runoff characteristics of pollutants from a small river basin during a rising stage of river flow, Advances in Asian Environmental Engineering, ... by alkalinity, Alkalinity: Titration method (*2320 B) Analytical methods are numbered in Standard Methods for the examination of water and wastewater - 185 - Journal of Water and Environment...

Ngày tải lên: 05/09/2013, 09:08

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

... word phrase on latent dirichlet allocation Forum on Data Engineering and Information Management,i-6 Yee W Teh, David Newman, and Max Welling 2006 A Collapsed Variational Bayesian Inference Algorithm ... Summarization. (in Japanese) ohmsha Manabu Okumura and Hajime Mochizuki 2000 QueryBiased Summarization Based on Lexical Chaining Computational Intelligence,16(4):578–585 Qin Bing, Liu Ting, Zhang Yu, and ... Thomas K Landauer, and Richard Harshman 1990 Indexing by Latent Semantic Analysis Journal of the American Society of Information Science, 41(6):391– 407 Shotaro Matsumoto, Hiroya Takamura, and Manabu...

Ngày tải lên: 23/03/2014, 16:20

Ngày tải lên: 30/03/2014, 01:20

... published papers in International Journal of Production Research, International Journal of Human Resource Management, Journal of Business and Industrial Marketing, Supply Chain Management: An International ... organisational performance in a supply chain and follow-up mailing procedure Plant and operations managers were targeted because of their particular knowledge related to manufacturing, purchasing, ... across the supply chain Searching for new ways to integrate SCM activities Creating a greater level of trust throughout the supply chain Identifying and participating in additional supply chains...

Ngày tải lên: 28/05/2014, 20:34

... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...

Ngày tải lên: 18/06/2014, 18:20

... U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb acy gcn cct tch cct ttc ccc aat ... cells are liver macrophages and Hepatocytes are liver endothelial cells 2B-cells priate primer set (Table 2) A band of about 400 bp was seen after PCR analysis, indicating HHV- 6A was replicating in ... of HIV1 and HCV in the same cell may greatly aggravate the malady Our TEM analysis showed HHV- 6A and HCV in the same cells, with extracellular HIV-1 particles budding or adjacent to the infected...

Ngày tải lên: 20/06/2014, 01:20

... 43–52, Karl-Franzens-Univ Graz, Graz, Austria, 2004 21 L C˘ dariu and V Radu, A Hyers-Ulam-Rassias stability theorem for a quartic functional equation,” a Automation Computers and Applied Mathematics, ... M Rassias, “On approximation of approximately linear mappings by linear mappings,” Journal of Functional Analysis, vol 46, no 1, pp 126–130, 1982 J M Rassias, “Solution of a problem of Ulam,” ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Z Gajda, “On stability of additive mappings,” International Journal of Mathematics and Mathematical Sciences, vol...

Ngày tải lên: 22/06/2014, 06:20

... on findings at autopsy, aspiration or asphyxia, or asthma attack ARDS was clinically defined by meeting four criteria: acute onset; bilateral fluffy pulmonary infiltrates by x-ray; pulmonary artery ... pneumonia, and also demonstrated pathological evidence of DAD The one patient that died of an acute asthma attack also had ARDS, but it was the asthma attack that was the fatal event Respiratory ... TBSA burn Inhalation injury was present in 20% of all admitted burns Figure Brain deaths Brain injury accounted for 16% of all deaths Anoxic brain injury accounted for 48% of the brain deaths after...

Ngày tải lên: 13/08/2014, 20:21

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 18/06/2014, 22:20

... Kappa 10 Kappa 11 C region kappa primer Signal sequence/framework primers Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma Gamma 10 Gamma 11 Gamma 12 Gamma 13 Gamma 14 Gamma 15 Gamma 16 C region ... Table 1: Degenerate PCR primers used for amplification of VL (kappa) and VH (gamma) Nomenclature Signal sequence/framework primers Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa Kappa ... TCAGCTTCYTGCTAATCAGTG TGGGTATCTGGTRCSTGTG GTTTCMAGGTRCCAGATGT TGTTTTCAAGGTRCCAGATGT CTSTGGTTGTCTGGTGTTGA TGCTKCKCTGGGTTCCAG TGGTGGGAAGATGGA GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG AGGTVMAACTGCAGVAGTCWGG...

Ngày tải lên: 20/06/2014, 04:20

... consisting of fragment forward primers: abl_1F (5’-tggttcatcatcattcaacggtgg-3’) and reverse primers: abl_1R (5’-tctgagtggccatgtacagcagc-’3), and fragment forward primers: abl_2F (5’-tcatgacctacgggaacctc-3’) ... primers, forward (b-actin_F) (5’-gtggggcgccccaggcacca-3’) and b-actin_R (5’-gtc cttaatgtcacgcacgatttc-3’) [27] First, the AS-PCR was optimized by varying annealing temperature (Ta) (55° to 62°C), ... leukemia Cancer Cell 2002, 2:117-125 19 Corbin AS, La Rosee P, Stoffregen EP, Druker BJ, Deininger MW: Several Bcr-Abl kinase domain mutants associated with imatinib mesylate resistance remain sensitive...

Ngày tải lên: 10/08/2014, 21:23

... GCCGGGCCGGGACAC GGCGATGTC Not applicable Sense primer ATTCAGAAAACTC CCCAAATTCAAG TGTAC GGCCGCCCTGGCCCCGAC CCAGACC CGCGCGCACAGTTTTAA TTGTGGAG GGGAATTTGGAGGTGGC GGGTCCGG AGGTGGCGGGTCCATTCAG AAAACT CCCCAAATTCAAGTGTACT ... Sense primer ATTCAGAAAACTC CCCAAATTCAAG TGTAC GGCCGCCCTGGCCCCGAC CCAGACC CGCGCGGGGGCCTTCCT CACCAATG TTCCCTACGGAGGTGGCG GGTCCGG AGGTGGCGGGTCCATTCAG AAAACT CCCCAAATTCAAGTGTACT CTCGCC ATCCA CCTGCTGCTGGCGGCC ... TCGAAAT ACCGCATCGAGTGAGAGCC GGACCC GCCACCTCCGGACCCGCC ACCTCCG GACCCGCCACCTCCGGAC CCGCCAC CTCCCATGTCTC GCTCCCCGAGGCCGG GCCGGGACACGGCGA Sense Primer ATTCAGAAAACTC CCCAAATTCAAG TGTAC GGAGGTGGCGGGTCCATTC...

Ngày tải lên: 13/08/2014, 05:21

... contain fast Na+ channels at a higher density than that in the surface sarcolemma [9,15,16] Transverse propagation also occurred by the same EF mechanism between adjacent parallel chains that ... MΩ/2) (Table 1) A Propagation velocity in single chains Variation in number of gj-channels (100-cell chain) The overall velocity of propagation (θov) increased markedly with an increase in number ... for a 100-cell chain (Table 2) Variation in length of single chain The length of the single chain was also varied, and different numbers of gj-channels were inserted These results are depicted in...

Ngày tải lên: 13/08/2014, 16:21

... time Because the agent can always underreport and steal at rate γR until termination, any incentive compatible strategy yields the agent at least R In contrast, this constraint may bind in a discrete-time ... parameters on the agent’s starting value W* when investors have all the bargaining power is determined by the following tradeoff: Larger W* delays termination at a greater cost of paying the agent ... principal randomizes when the agent defaults) Second, because cash flows may be arbitrarily negative in a continuous-time setting, the contract may involve a compensating balance requirement as...

Ngày tải lên: 12/01/2014, 22:16

... (5¢-GAT AAAACCACACCTGTAGTAGCTG-3¢) and MCAD 116 5A G (5¢-CCTGTAGAAAGACTAATGAGGGATG CC-3¢) (mutagenic substitutions are shown in bold), and the antisense primer (5¢-GTAACGCCAGGGTTTTCCCA GTCAC-3¢) ... 548–556 15 Ikeda Y, Okamura-Ikeda K & Tanaka K (1985) Purification and characterization of short -chain, mediumchain, and long -chain acyl-CoA dehydrogenases from rat liver mitochondria: isolation of ... studied in rat MCAD, where the arginine was mutated to alanine, lysine, glutamine and glutamic acid The authors found that the lysine mutant exhibited significantly reduced activity, whereas the...

Ngày tải lên: 20/02/2014, 02:21

... in a statistical data analysis based on a partition of a set of objects into groups or clusters (Manning and Schütze, 1999) Multidimensional scaling is data analysis technique that provides a ... that factors are most important, explaining 35% of the total amount of variance The main drawback of applying this technique in dialectometry is that it is not directly related to the aggregate ... them aggregate over the entire available data, failing to extract linguistic structure from the aggregate analysis Two attempts to overcome this withdraw are presented in Nerbonne (2005) and Nerbonne...

Ngày tải lên: 20/02/2014, 12:20

... generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domain that contains an essential Ca2+binding site in the mammalian ... obtained from the Japan Snake Institute, Gunma, Japan Phenyl Sepharose CL-4B, DEAE Sepharose CL-6B and Superdex 75 were purchased from Amersham Pharmacia Biotech; Concanavalin A (Con A) agarose ... Yasuda, T., Sawazaki, K., Nadano, D., Takeshita, H., Nakanaga, M & Kishi, K (1993) Human seminal deoxyribonuclease I (DNase I): purification, enzymological and immunological characterization and...

Ngày tải lên: 20/02/2014, 23:20

... Shanghai Second Reagent Plant, Shanghai, China Cytochrome c was obtained from Tianjin Biochemical Plant (Tianjin, China) Hepes was from Fluka All other chemicals were of analytical grade Generation ... be an alternative approach to protecting cells from oxidative damage In many mitochondria, catalase is lacking [46] Thus, GPXs, including cGPX and PHGPX, play an important role in scavenging ... Mitochondrial swelling therefore characterizes its integrity It can be correlated with changes in light scattering A decrease in A5 20 reflects an increase in mitochondrial swelling and a decrease in mitochondrial...

Ngày tải lên: 21/02/2014, 00:20