structure based design of novel p2 p4 macrocyclic inhibitors of hepatitis c ns3 4a protease

Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

Ngày tải lên : 20/06/2014, 01:20
... origin of quasispecies: cause or consequence of chronic hepatitis C viral infection? J Hepatol 2005, 42:408-417 Kenny-Walsh E: Clinical outcomes after hepatitis C infection from contaminated anti-D ... Separation of a complex mixture of antibody enriched and antibody depleted HCV particles is technically not trivial Centrifugation based separation, with respect to IgG, can be incomplete with fraction ... Pure LC (Roche Diagnostics Ltd UK,) according to the MagNA Pure LC Total Nucleic Acid Isolation Kit protocol (Catalogue No: 03038505001, Roche Diagnostics Ltd., UK) from 25 μl of an unfractionated...
  • 9
  • 288
  • 0
Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx

Tài liệu Báo cáo khoa học: Crystal structure of Trypanosoma cruzi glyceraldehyde-3-phosphate dehydrogenase complexed with an analogue of 1,3-bisphospho-D-glyceric acid Selective inhibition by structure-based design docx

Ngày tải lên : 20/02/2014, 02:21
... Bre´sil (COFECUB) (contract no 294 H99) which is fully acknowledged We acknowledge La socie´te´ de Secours des Amis des Sciences and the European Cooperation in the Field of Scienti c and Technical ... dehydrogenase from Escherichia coli: direct evidence of substrate binding and cofactorinduced conformational changes Biochemistry 39, 10702–10710 27 Kim, H & Hol, W.G.J (1998) Crystal structure of Leishmania ... 5¢-CAACAAATTTGCATATGACTATT AAAG-3¢ containing an NdeI site (underlined) next to the start codon of the T brucei gGAPDH gene; an antisense primer 5¢-CAGCCAAGCGCCTAGGGAGCGAGA AC-3¢, containing a...
  • 13
  • 588
  • 0
Model-Based Design for Embedded Systems- P4 ppt

Model-Based Design for Embedded Systems- P4 ppt

Ngày tải lên : 02/07/2014, 15:20
... 3.1 Core Execution/Communication Time and Memory Access Time Per Task HW Multicore ECU ECU1 ECU2 ECU3 ECU4 CAN Bus Task Name Exec./Comm Time (in ms) Memory Access Time Scheduling Parameter ctrl1 ... two considered system properties subject to maximization exec1 Act1 exec2 Act2 C1 Shared memory ECU1 ctrl1 eval1 mon1 Sens1 mon2 Sens2 C2 ctrl2 eval2 ECU2 Multicore ECU ESP HW calc C3 mon3 Sens3 ... layers of communication stacks or communications over networks interconnected by gateways, where several packets may be combined into some higher-level communication structure This can be captured...
  • 30
  • 416
  • 0
Model-Based Design for Embedded Systems- P4 pptx

Model-Based Design for Embedded Systems- P4 pptx

Ngày tải lên : 03/07/2014, 17:20
... abstract component is a model of the processing semantics of a concrete component, for instance, an application task or a concrete dedicated HW/SW unit An abstract component models the execution of ... transformation of event -based curves into resource -based curves and vice versa is done by means of so-called workload curves which are VCCs 14 Model -Based Design for Embedded Systems αu # Events # Cycles ... an abstract and a concrete GPC Abstract components transform input VCCs into output VCCs, that is, they are characterized by a transfer function that relates input VCCs to output VCCs We say...
  • 10
  • 385
  • 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Ngày tải lên : 06/03/2014, 11:20
... structure and function of the eRF1 C- domain A B C E D Fig The solution structure of the C- domain (A) Stereo view of the ensemble of the final 48 calculated structures Twenty-four structures of ... chain factors, eukaryotic class polypeptide chain release factor (eRF1) and eukaryotic class polypeptide chain release factor (eRF3) The major functions of eRF1 include recognition of each of the ... but still detectable Effect of mutations in the minidomain on stop codon specificity Superposition of the NMR structure of the human C- domain on the full-length crystal structure of eRF1 reveals...
  • 17
  • 490
  • 0
Báo cáo khoa học: "Coherent Citation-Based Summarization of Scientific Papers" potx

Báo cáo khoa học: "Coherent Citation-Based Summarization of Scientific Papers" potx

Ngày tải lên : 23/03/2014, 16:20
... sentences and the extracted scopes, and counted the number of correctly/incorrectly tagged (extracted)/missed references (scopes) Our tagging 506 component achieved 98.2% precision and 94.4% recall ... and Of Information Science 2000 Classification of research papers using citation links and citation types: Towards automatic review article generation M E J Newman 2001 The structure of scienti c ... David Zajic 2009 Using citations to generate surveys of scienti c paradigms In Proceedings of Human Language Technologies: The 2009 Annual Conference of the North American Chapter of the Association...
  • 10
  • 319
  • 0
Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx

Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx

Ngày tải lên : 12/08/2014, 04:20
... Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' BHQ BHQ: Black Hole Quencher dye and IC were labelled with 6-carboxyfluorescein ... reference material for HCV RNA 2.26 × 103 IU/ml National reference material for HCV RNA 2.26 × 102 IU/ml IC (Cy5)Ct HCV (FAM)Ct IC (Cy5)Ct HCV (FAM)Ct IC (Cy5)Ct HCV (FAM)Ct IC (Cy5)Ct HCV (FAM)Ct ... Primer/probe sequence (5' 3') Position As 5'-GAGTAGTGTTGGGTCGCGAA-3' 256 275 Aa 5'-GTGCACGGTCTACGAGACCTC-3' 320 340 Ap FAM5'-CCTGATAGGGTGCTTGCGAGTGCC-3' BHQ 292 315 Bs 5'-AGCGTCTAGCCATGGCGTTAGTAT-3'...
  • 9
  • 322
  • 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Ngày tải lên : 02/11/2012, 09:56
... [Internet] CDC: US Viral Hepatitis C http://www.cdc.gov/ncidod/diseases /hepatitis/ c/ plan/Prev_Co ntrol.htm 84 Backmund M, Reimer J, Meyer K, Gerlach JT, Zachoval R Hepatitis C virus infection and injection ... for Hepatitis C virus all need to be elucidated Conflict of interest The authors have declared that no conflict of interest exists References WHO Global surveillance and control of hepatitis C ... Vincelette J, Lavoie R, Turmel B, Remis RS Lack of evidence of sexual transmission of hepatitis C virus in a prospective cohort study of men who have sex with men American Journal of Public Health...
  • 6
  • 486
  • 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

Ngày tải lên : 02/11/2012, 09:56
... estimated 10%20% of chronic HCV infections advance to end-stage liver disease over one or two decades Extrahepatic manifestations can occur during chronic HCV infection or cirrhosis, but HCC appears ... and/or hepatocellular carcinoma.[3] 50 Summary The chronic nature of hepatitis C infection influences the clinical approach and management of this disease Prevention of the HCV infection is possible ... 21(1): 77-82 57 Nishiguchi S, et al Randomised trial of effects of interferon-alpha on incidence of hepatocellular carcinoma in chronic active hepatitis C with cirrhosis Lancet, 1995 346(8982):...
  • 6
  • 530
  • 0
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"

Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"

Ngày tải lên : 02/11/2012, 10:00
... a cofactor for the NS3 serine protease The crystal structure of the NS3- 4A complex revealed that NS4A is an integral component of the enzyme core [41] Surprisingly, the NS3 serine protease recently ... Rice CM Efficient initiation of HCV RNA replication in cell culture Science 2000; 290: 1972-4 Bartosch B, Dubuisson J and Cosset FL Infectious hepatitis C virus pseudo-particles containing functional ... J Med Sci 2006, 30 Figure Life cycle of HCV The steps of the viral life cycle are depicted schematically The topology of HCV structural and nonstructural proteins at the endoplasmic reticulum...
  • 6
  • 497
  • 1
Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Tài liệu Báo cáo khoa học: Limited suppression of the interferon-b production by hepatitis C virus serine protease in cultured human hepatocytes pptx

Ngày tải lên : 18/02/2014, 16:20
... (accession no AB093555) were 5¢-AAGCCATGATGAGCAACCTC-3¢ and 5¢-GTGTCC TGTTCCTTCCTCCAC-3¢ The sequences of sense and antisense primers for RIG-I (accession no NM_014314) were 5¢-AATGAAAGATGCTCTGGATTACTTG-3¢ ... (B) Cardif is cleaved by NS3- 4A in the cured Oc cells The Oc cells were cotransfected with the myc-Cardif (wild-type or mutant C5 08A) and NS3- 4A expression vectors The production of the myc-Cardif ... immunoblotting as described in Fig 6C The black arrowhead indicates the noncleaved TRIF O cells A MycMyc- Cardif Cardif C5 08A 75 kDa 50 37 NS3 b-actin Oc cells B Myc-Cardif C5 08A Myc-Cardif (Strain)...
  • 16
  • 523
  • 0
Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Ngày tải lên : 20/02/2014, 01:20
... CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG ... AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA TAATACGACTCACTATAGGGGCACGCCCAAATCTC GCCAGCCCCCTGATGGGGGCGA AAATAATACGACTCACTATAGGCATTGAGCGGGTTTATCC GCCAGCCCCCTGATGGGGGCGA...
  • 15
  • 597
  • 0
Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

Ngày tải lên : 08/03/2014, 02:20
... amino terminus, was amplified by PCR using the following primers: forward, 5¢-CATGCC ATGGCGCCATTTTTCTTGAGACATGCC-3¢; reverse, 5¢-CTGGGATCCGTCCGAATCAGGTTCCTTC-3¢ (purchased from Sigma), and the pKK ... and side-chain conformational changes, occur upon binding of ATP and nucleic acid to ensure ATPase activity Analysis of the mode of binding of ATP in the HCV NTPase/helicase structure explains ... Inhibition of NTPase/helicase activities of hepatitis C (Eur J Biochem 270) 1653 30 Gwack, Y., Kim, D.W., Han, J.H & Choe J (1996) Characterization of RNA binding activity and RNA helicase activity of...
  • 9
  • 659
  • 0
Diagnosis, Management, and Treatment of Hepatitis C: An Update docx

Diagnosis, Management, and Treatment of Hepatitis C: An Update docx

Ngày tải lên : 08/03/2014, 14:20
... Interpretation Acute or chronic HCV depending on the clinical context Resolution of HCV; Acute HCV during period of low-level viremia Early acute HCV infection; chronic HCV in setting of immunosuppressed ... more of the clinical complications of chronic liver disease — ascites, encephalopathy, variceal bleeding, and/or impaired hepatic synthetic function — is more problematic Their treatment of choice ... due to direct percutaneous exposure to infectious blood because of inadequate infection control.240 Its source is cross-contamination between patients because of lack of disinfection of commonly...
  • 40
  • 998
  • 0
Management of hepatitis C pot

Management of hepatitis C pot

Ngày tải lên : 08/03/2014, 14:20
... estimated from the prevalence of chronic hepatitis C (CHC).63 Acute hepatitis C infection is usually asymptomatic 64 The full clinical spectrum of acute hepatitis C symptoms can occur but is rare (
  • 55
  • 323
  • 0
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf

Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf

Ngày tải lên : 16/03/2014, 05:20
... mechanisms antiviral screening entry process replication mechanisms intracellular host defences antiviral screening cell attachment vaccination morphogenesis entry process HCVcc Entire life cycle ... development of HCV-like particles, another model was created to specifically investigate the entry process of HCV This system is called pseudo particles of HCV (HCVpp), as envelope glycoproteins of HCV ... support infection technical difficulties of primary cell culture no secretion of particles independence of CD81 for entry no budding at the ER exogenous core no association of particles with lipoproteins...
  • 14
  • 532
  • 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Ngày tải lên : 18/06/2014, 18:20
... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 Background2 Background3...
  • 12
  • 354
  • 0
Novel biomarkers predict liver fibrosis in hepatitis C patients: alpha 2 macroglobulin, vitamin D binding protein and apolipoprotein AI pdf

Novel biomarkers predict liver fibrosis in hepatitis C patients: alpha 2 macroglobulin, vitamin D binding protein and apolipoprotein AI pdf

Ngày tải lên : 10/08/2014, 05:21
... B, Speers D, George J, Kench J, Farrell G, McCaughan GW, Jeffrey GP: Hepascore: an accurate validated predictor of liver fibrosis in chronic hepatitis C infection Clin Chem 2005, 51:1867-1873 Tiggelman ... Acknowledgements This project was supported by the grant NSC96-3111-P-042A-004-Y from National Science Council of Republic of China and the founding of Cheng Hsin Rehabilitation Medical Center 10 11 12 ... cited This is an Open Access from: http://www.jbiomedsci.com/content/17/1/58 Journal of et available article distributed under article is al; licensee BioMed Central References Marcellin P: Hepatitis...
  • 7
  • 253
  • 0
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

Ngày tải lên : 10/08/2014, 23:21
... Journal of Medical Case Reports 2011, 5:246 http://www.jmedicalcasereports.com/content/5/1/246 Graduate Institute of Clinical Medical Sciences, Chang Gung University, College of Medicine, Taoyuan, ... N: Chronic hepatitis C virus infection in renal transplant: treatment and outcome Clin Transplant 2006, 20:677-683 Yen TH, Huang CC, Lin HH, Huang JY, Tian YC, Yang CW, Wu MS, Fang JT, Yu CC, Chiang ... for chronic HCV infection, the strategy for posttransplantation anti-HCV therapy remains inconclusive [2] In our Chang et al Journal of Medical Case Reports 2011, 5:246 http://www.jmedicalcasereports.com/content/5/1/246...
  • 4
  • 282
  • 0