structural biology and structural genomics a federal agency perspective

... Cell Biology and Cancer • personal and community health Activities 1, 4, and • natural and human-induced hazards Activities 1, 4, and 23 Ä Cell Biology and Cancer • science and technology in local, ... explanations and models using logic and evidence Activities 2, 3, and • Recognize and analyze alternative explanations and models Activity • Communicate and defend a scientific argument Activity ... life; as a class, they assemble data about the population as a whole Students examine the data the class assembles and draw a set of important generalizations about cancer from them These generalizations...

Ngày tải lên: 15/03/2014, 00:20

... ways particular activities are carried out and signaled Using Conversation Analysis (CA) as the methodology, this study illustrates the cultural characteristics of the format and interactional ... is actually great variation in the way they are realized across languages, institutions and individuals Every time we open a phone call, we must find an appropriate way to various contextual variables ... the familiar "Allo," and they often add their name and the phrase "Qui est a l"appareil?" that is, "Who is on the phone?" In Brazil, after slowly and patiently dialing a number, if you are lucky...

Ngày tải lên: 02/03/2015, 14:37

... ways particular activities are carried out and signaled Using Conversation Analysis (CA) as the methodology, this study illustrates the cultural characteristics of the format and interactional ... anybody learning a foreign language and remains a sensitive area in intercultural encounters, even for those who have mastered the basics of a foreign language and culture Inexperience in dealing ... Communication, and Social Meaning Edited by James E Alatis; Georgetown University Round Table on Languages and Linguistics (GURT) 14 Harmeet Sawhney, George A Barnett (1999), Advances in telecommunications,...

Ngày tải lên: 10/08/2015, 19:52

... traditionally spoken as a native language (England, the United States, Canada, Australia, and New Zealand); the outer circle, where English has a substantial societal role and often official ... fluctuating and often contradictory efforts of language learners in her study Whereas motivation treats desire to learn a language in the same manner as it does gender and age, as a static trait assigned ... of English and the place of the so-called 'native speaker' are central Rajagopalan (1997), for example, asserts that the categories of ‘native speaker’ 12 and ‘non-native speaker’ are themselves...

Ngày tải lên: 11/09/2015, 10:06

... La Jolla, USA), Andrzej Joachimiak (Midwest Center for Structural Genomics (MSGC) and Argonne National Laboratory, Argonne, USA), and one of us (T.E.) described systems to automate and integrate ... production, structural biology has also become large-scale through advances that extend the range of structural biology to exploration of large macromolecular assemblies, real-time visualization of ... Hol (Structural Genomics of Pathogenic Protozoa (SGPP) and University of Washington, Seattle, USA) promoted the advantages of microcrystallization trials in plastic capillaries These capillaries...

Ngày tải lên: 14/08/2014, 14:21

... for crystallization trials using biophysical methods A summary of a typical preparation for each clone, and the preparation and characterization data is given in Table Selection of clones and protein ... (TGAGCGGATA ACAATTTCAC ACAG) and pQE276 (GGCAACCGAG CGTTCTGAAC), annealing temperature 65°C PCR products were tag-sequenced using primer pQE65 Additional data files Click here strength expression data ... resistance to 15 µg/ml kanamycin and carries the lacIQ repressor and the argU gene for the arginine tRNA that recognizes the rare codons AGG and AGA The low abundance of this tRNA is especially...

Ngày tải lên: 14/08/2014, 14:21

... added a BamHI site upstream from the ATG codon, using the 5¢-end primer (5¢-CTACTACGAATTAGGATCCCCT GCACCTTG-3¢) and the 3¢-end primer (5¢-GTAATACGA CTCACTATAGGGCGAATTGGG-3¢) Amplification was performed ... markers were supplied by Sigma Aldrich (Milan, Italy) Reagents for bacterial growth were purchased from Fluka (Milan, Italy) T4 DNA ligase and Taq polymerase were from Stratagene (La Jolla, CA, ... MT A (m) and mussel MT 10 (n) as a function of the temperature increase from 20 to 90 °C The absorbance decrease at 254 nm was reported as a fraction of the standard absorbance (absorbance at...

Ngày tải lên: 19/02/2014, 07:20

... TVP-VAR (General) TVP-VAR (Standard) TVP-VAR (Homoscedastic) TVP-FAVAR TVP-FAVAR (Homoscedastic) FAVAR UC TVAR (GDP) TVAR (Inflation) TVAR (Rate) ST-VAR (GDP) ST-VAR (Inflation) ST-VAR (Rate) VAR ... models that incorporate a gradual change in parameters and also include a large set of explanatory variables particularly well as far as the inflation forecast is concerned recording gains (over ... Time-varying parameters, stochastic volatility, VAR, FAVAR, forecasting, Bayesian estimation JEL classification: C32, E37, E47 (1) External MPC Unit Bank of England Email: alina.barnett@bankofengland.co.uk...

Ngày tải lên: 06/03/2014, 14:20

... increase active-site local stability and reduce catalytic activity of a coldadapted alkaline phosphatase Biochim Biophys Acta 1774, 679687 32 Janeway CML, Xu X, Murphy JE, Chaidaroglou A & Kantrowitz ... standard assay and EPR spectra of the spin-labeled WT AP were measured after incubation in urea The scaled mobility factor (Ms) was calculated from the central linewidth of the EPR spectra packs ... these areas We also chose to place The activity and stability of the Vibrio AP was measured for each mutation, before and after spinlabeling Furthermore, the activity and stability of the spin-labeled...

Ngày tải lên: 16/03/2014, 01:20

... unsuccessful to date Nevertheless, by adopting an alternative approach, a small family of three thylakoid-associated kinases (TAKs) have been identified in A thaliana as candidates for LHCII kinases through ... the aquatic unicellular green alga Chlamydomonas reinhardtii and land plants In particular, the greater extent of state transitions in Chlamydomonas compared with higher plants, such as Arabidopsis, ... substrates of these two protein kinases remain to be determined The common structural features of all the LHCII kinases characterized to date are a putative single transmembrane domain and a large...

Ngày tải lên: 16/03/2014, 06:20

... (Tables and 2) revealed the same linkage pattern and sugar sequence as in the polysaccharide of P penneri (structure 1) and one additional sugar residue (a- GlcpII) attached at position of GalNAcI ... inter alia, signals for four anomeric protons at d 4.59±4.96 and two N-acetyl groups at d 2.05 and 2.06 Therefore, the polysaccharide has a tetrasaccharide repeating unit containing one residue each ... Polyclonal O-antisera were obtained by immunization of rabbits with heat-inactivated bacteria of P penneri and according to a published procedure [11] Agglutination and precipitation tests, SDS/PAGE,...

Ngày tải lên: 17/03/2014, 17:20

... the statistical analysis JL and ZZ drafted the manuscript All authors read and approved the final manuscript Additional data files The following additional data are available Additional data file ... Hu A Ma ma ka ive ma mm erteb nima ryo rsa te n l rat al te l e Protein age Figure SNP A/ S3ratios and evolutionary variables SNP A/ S ratios and evolutionary variables (a) Proteins with paralogs ... breadth for breadth not change qualitatively example A/ S ratios data Carlo sampling topartial correlations between and Tablehere forbetweenS1-S3 variables Figurestudy, Figure S2 conAdditionalandfile...

Ngày tải lên: 14/08/2014, 08:21

... TGACCATGGGACATCATGCCAGCAGAG TGACCATGAAACAAAGGCGGGCTCTATA TGACCATGCAAGCACATGCAAACGTACAC TGACCATGTTCGTGCGAGGGTAGCTACT TGACCATGGGGAATCCGTAACCATAACACA TGACCATGGATCCGAGCGTGTACATTTG TGACCATGAATAAAAAAGACAGCGCCCT TGACCATGGGAAAAATAACGTCTCGCTTGA ... TGACCATGTACTGTCTGATATTGAAA TGACCATGATGACCCCAAAGTTTACGGG TGACCATGCATTCACGCTAAACTCGACG TGACCATGAAGAAGTGGCGTTTGGACA TGACCATGAATGGAAAACGCGCAGTC TGACCATGACGAAGCGTGGGAACATTT TGACCATGTAACGGTGAACCAAACAG TGACCATGGGTATTTTTCAGCCTCCATTCC ... TGACCATGTGATACGAGCGCACGGAAG TGACCATGACCGGGCGAAAGTTTATCA TGACCATGGACACTGAAAAAGATTGCGTTG TGACCATGACGAAGACAGCTGGGCCAT TGACCATGAAAACCATCACGATTGACGTC TGACCATGAATGCTAGTCATGTATCTCGGG TGACCATGAGACCCACGCCTATAGACAGAT...

Ngày tải lên: 11/09/2015, 16:04

... DNA Gene specific primers were 5’CGCGGATCCATGCAGATCTTTGTGAAAACTCTT 3’ and 3’CCGGAATTCTTACACTCCTCCTCTCAATCGC 5’ which are adapted with BamHI and EcoRI enzyme restriction site The PCR reaction was ... phosphorodiamidate backbone, were evaluated for resistance to a variety of enzymes and biological fluids A 25-mer was incubated with nucleases, proteases, esterases, and serum, and the reaction mixtures ... 4-plex iTRAQ Each reagent consists of a charged reporter, a peptide reactive group and a neutral balance portion to maintain an overall mass of 145 Da The charge reporters, from 114 to 117 Da, are...

Ngày tải lên: 14/09/2015, 14:11

... TGACCATGCCGAATGTTTGACCCGAA GAGCGCGGACAAGATGGAT ORF046L TGACCATGGGACGCGAACGATATAGTGA GAAGTCCTTGAGGGCCTGGT ORF101R TGACCATGACGAAGACAGCTGGGCCAT CGATCTAAAGGTTCCACGACG ORF125R TGACCATGCCGTGCGTGGGTATGTGTA CATTGACCTCCTGAGAACGTTC ... Knock-down target Synthesized MO Target location Negative control CCTCTTACCTCAGTTACAATTTATA ORF018R GCGTTCAGATAGTTTTACGGACATC -1 +24 ORF135L AATACGCTTGTACGAGTTCTTCCAT +25 ORF140R GACCCCTAAATTCTGACATTTTTAT ... CATTGACCTCCTGAGAACGTTC ORF136R TGACCATGGGATGAATCAAGAAATGCAGAC GAAAAGGGATGCAGCAACA 106 4.3 Results and Discussions: 4.3.1 MO knock-down of ORF018R, ORF140R and ORF135L To examine the specificity and efficiency...

Ngày tải lên: 14/09/2015, 14:11

... considering declaring a material adverse change, which, as a matter of contract law, can, if upheld, allow an acquirer to avoid to consummate a deal Treasury and Federal Reserve representatives asked us ... American people demand to be answered, and I know that the chairman and the ranking member talked about that We look forward to that happening in a bipartisan fashion in the near future VerDate ... that we should not call a MAC, a material adverse change So as a result of that, that was a factor in our decisions, because here your regulators and the Federal Government was saying we VerDate...

Ngày tải lên: 06/03/2014, 09:22

... a qualitative examination of four regions and the savings banks which operate in them Question 4: What form should a structural policy aimed at growth and equalisation take and how can such a ... Studies Savings Banks’ Spatial Environment and Returns Regions and their Savings Banks E The Challenges of a Balanced Structural Policy Savings Banks as Players in a Balanced Structural Policy ... trade similarly addressed spatial issues According to Krugman, area and geography did in any case always play a certain part in theory beyond classic economics Even in the past, certain areas...

Ngày tải lên: 06/03/2014, 10:20

... of Science, Jazan University, Jazan, Kingdom of Saudi Arabia *Corresponding Author: kismail@jazanu.edu.sa, sayeedkhatib@hotmail.com Abstract Smear microscopy and culture forms the backbone of tuberculosis ... number of cases and financial constraints Ethical Approval The study was approved by the institutional ethics committee of TN Medical College and BYL Nair Charitable Hospital, Mumbai, India Conflict ... (TB) laboratory investigations in tertiary healthcare facilities which have a large number of cases and financial constraints The present study aimed to re-evaluate the efficiency of smear microscopy...

Ngày tải lên: 15/03/2014, 03:20

... in their area AARP has several plans and programs in this area that are going on at the present time Preventive health services and health promotion programs must be made available and accessible ... if they can read it, to understand it I wear trifocals and I can't read it any more We pay for that, and yet we have new Packaging available that State Medicaid will not pay for because it s ... problems created by the disease Additionally, AOA has developed a four volume technical assistance handbook on Alzheimer's disease to provide background materials and to assist States and local governments,...

Ngày tải lên: 22/03/2014, 13:20

... Genus Cardamine Arabidopsis Rosa Luzula Oryza Rosa Gnetum Zea Nicotiana Ginkgo Allium Pinus Fritillaria Species 1C pg amara thaliana wichuraiana pilosa sativa moyesii ula mays tobaccum biloba sativum ... experimental detail and observations span very diverse plant material, rather than all being available in a convenient single model organism Thus algae may be appropriate models for photosynthesis and ... the deliberations of this group two banana BAC libraries, one from M acuminata “Calcutta 4” and the other from M balbisiana “Pisang Klutuk Wulung,” have been constructed and made available to the...

Ngày tải lên: 08/04/2014, 13:07