stress fear and the presence of a weapon
A park like transformation for the study and the control of a nonsinusoidal brushless DC motor
Ngày tải lên :
03/01/2014, 19:44
... permanent magnets of the rotor : where L, and M, are the self-inductance and the mutualinductance of the stator coils Since we assume a constant airgap and no saturation, L, and M, are constant ara arb ... The airgap length is constant and large since the magnets are surface mounted and have the same permeability as air As a result, the armature reaction is negligible The magnetic circuit has an ... this paper a new transformation which preserves the same advantages as the Park transformation A Mathematical Model of the BDCM We suppose that the motor has the following typical features : - The...
- 8
- 517
- 1
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
Ngày tải lên :
20/02/2014, 01:20
... structure of the protein Figure shows the fluorescence spectra of wild-type SNase and the four mutants E142O, K13 3A, W14 0A and W140O The fluorescence spectra of E142O and K13 3A are similar to that of the ... 50 mm NaHPO4 ⁄ 200 mm NaCl, pH adjusted to 7.0) at a concentration of 0.5 mgÆmL)1 Spectra were obtained as the average of five successive scans with a bandwidth of 1.0 nm and a scan speed of 20 ... is partially supported by a grant (NSC92-2311-B-001) from the National Science Council, Taiwan, R.O.C and the theme project of Academia Sinica, Taipei, Taiwan, R.O.C 3965 Staphylococcal nuclease...
- 7
- 551
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
Ngày tải lên :
07/03/2014, 12:20
... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...
- 11
- 548
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
Ngày tải lên :
08/03/2014, 09:20
... into pC4Meth94PhoE, the EcoRI/BamHI fragment of the plasmid was replaced by PCR fragments created using the PhoE forward primer (5¢-GCCGGAATTCTAATATGAAAAAGAGCACTCT GGC-3¢) and the 94PhoE reverse ... using strain CE1224 as the recipient and strains IQ85 and strain MM152, respectively, as donor strains To obtain strain CE1513, strain MM88 was used as Table Bacterial strains and plasmids used ... PhosphorImager 473 (Molecular Dynamics) and quantified using the Imagequant software (Molecular Dynamics) To test the targeting of wild-type prePhoE RNCs, truncated mRNAs were translated in the presence...
- 8
- 546
- 0
Báo cáo khoa học: Kinetic analysis of zymogen autoactivation in the presence of a reversible inhibitor pptx
Ngày tải lên :
23/03/2014, 13:20
... for acceleration of the activation process [31] Desnuelle & Gabeloteau showed that in the presence of calcium ions the autocatalytic activation of trypsinogen is quantitative and therefore calcium ... in each case As the autocatalytic activation of trypsinogen is quantitative, the increase in trypsin activity shows the appearance of newly processed trypsin during the reaction, and the y scale ... than that obtained in the presence of 10 mM Ca2+ [23,35], indicating that the dominant effect of the Ca2+ concentration appears Fig Autocatalytic activation of trypsinogen by trypsin in the absence...
- 8
- 403
- 0
MUTUAL BANKING: SHOWING THE RADICAL DEFICIENCY OF THE PRESENT CIRCULATING MEDIUM, AND THE ADVANTAGES OF A FREE CURRENCY docx
Ngày tải lên :
29/03/2014, 08:20
... the standard of value still another 'The dollar is the measure of value Silver and gold at a certain degree of fineness, are the standard of value The bill of a Mutual Bank is a bill of exchange, ... in a twofold way, and has therefore a twofold value and a twofold price,—one value as an article that can be exchanged for other commodities, and another value as an article that can be loaned ... serve as a standard of value: but the bill of a Mutual Bank, having a legal value only, and not an actual one, cannot serve as a standard of value, but is referred, on the contrary, to silver and...
- 46
- 327
- 0
Báo cáo Y học: Stimulated biosynthesis of flavins in Photobacterium phosphoreum IFO 13896 and the presence of complete rib operons in two species of luminous bacteria Sabu Kasai and Takumi Sumimoto pot
Ngày tải lên :
31/03/2014, 08:20
... Finally, in Vibrionaceae (AE004298), Pseudomonadaceae (AE004821 and AE004822) and the Xanthomonas group (AE003934, AE011704 and AE012168), two genes, ribA and ribB, are fused as ribBA and the ... but remains as two separate genes, ribA and ribB In Vibrionaceae, Pseudomonadaceae and the Xanthomonas group, the rib genes are organized in a complete operon and two genes, ribA and ribB, are fused ... in 1% and 3% NaCl, was 67% and 33% of that of the three Ó FEBS 2002 mutants, respectively The maximum cell density of the parent cells cultured in 1% and 3% NaCl was 82% and 73% of that of M1,...
- 10
- 454
- 0
Báo cáo sinh học: " Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" pot
Ngày tải lên :
18/06/2014, 22:20
... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... Fig 2A Fig 2B Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and recTULV Figure Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and...
- 5
- 483
- 0
báo cáo hóa học:" Psychosocial stress, demoralization and the consumption of tobacco, alcohol and medical drugs by veterinarians" ppt
Ngày tải lên :
20/06/2014, 00:20
... cross-sectional study using the data of the pilot HAPIEE Study (Health, Alcohol and Psychosocial factors In Eastern Europe) Data were analysed from 694 men from Russia, Poland and the Czech Republic It was ... Jeyaratnam J, Jones H, Phillips M: Disease and injury among veterinarians Aust Vet J 2000, 78:625-629 Landercasper J, Cogbill TH, Strutt PJ, Landercasper BO: Trauma and the veterinarian J Trauma ... veterinary service at the weekends On the other hand most of the veterinarians are self-employed as the practice owner and they have to acquire their customers to compete with other practices In addition,...
- 11
- 458
- 0
báo cáo hóa học:" Recombinant Tula hantavirus shows reduced fitness but is able to survive in the presence of a parental virus: analysis of consecutive passages in a cell culture" ppt
Ngày tải lên :
20/06/2014, 04:20
... presence of TULV S RNA on passages, RT-PCR was performed with primers VF738 (5'GCCTGAAAAGATTGAGGAGTTCC3'; nt 738–760) and VR855 (5'TTCACGTCCTAAAAGGTAAGCATCA3'; nt 831–855) To monitor the presence of ... hantavirus recombination awaits further investigation Conclusion The data presented in this paper show that the recTULV presents no real match to the original cell adapted variant and that the ... Fig 2A Fig 2B Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and recTULV Figure Monitoring of wt and recS-RNA during sequential passages of the mixture of TUL02 and...
- 5
- 430
- 0
báo cáo hóa học: " Topological confinement in an antisymmetric potential in bilayer graphene in the presence of a magnetic field" pptx
Ngày tải lên :
21/06/2014, 02:20
... perpendicular external magnetic field, both for the case of a single potential kink, as well as for a kink-antikink pair One advantage of such a setup is the fact that in an experimental realization of ... the sequence alignment and drafted the manuscript GAF contributed in analysis of the numerical results All authors read and approved the final manuscript Competing interests The authors declare ... either presence of magnetic field (blue solid curves in panels (a, b)) The inset of panel (a) indicates that the wavespinors satisfy the a1 = ϕb3 and ϕb1 = − a3 relations at ky = and B0 = which leads...
- 10
- 471
- 0
báo cáo khoa học: " The presence of a lipoma in the Eustachian tube: a case report" pdf
Ngày tải lên :
10/08/2014, 23:20
... a soft consistency and had the gross appearance of adipose tissue Histological examination confirmed the diagnosis of fibrolipoma (Figure 3) Our patient was discharged the day after surgery and ... Int J Pediatr Otorhinolaryngol 1993, 25(1-3):183-189 Tanaka H, Kohno A, Gomi N, Matsueda K, Mitani H, Kawabata K, Yamamoto N: Malignant mucosal melanoma of the eustachian tube Radiat Med 2008, ... the surgery and helped in preparation of the final manuscript QL did the endoscopic examination and postoperative follow-up of our patient All authors read and approved the final manuscript Submit...
- 3
- 336
- 0
báo cáo khoa học: " Peritonitis secondary to traumatic duodenal laceration in the presence of a large pancreatic pseudocyst: a case report" ppsx
Ngày tải lên :
10/08/2014, 23:20
... and amended the manuscript LCT provided the photographs obtained at the time of surgery All authors read and approved the final manuscript Competing interests The authors declare that they have ... contributions VTM analyzed and interpreted the patient data regarding pancreatitis, pancreatic pseudocysts and gastrointestinal injuries following blunt trauma VTM and MMS wrote the manuscript MMS and LCT ... the gastrojejunostomy and a drain by the duodenal repair and his abdomen closed The drains were necessary due to the widespread peritoneal contaminations found during the laparotomy He made an...
- 4
- 251
- 0
Báo cáo y học: "Childhood adversity, mental ill-health and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system" ppt
Ngày tải lên :
13/08/2014, 18:22
... years (range - 16) at t2 The Tanzanian and German board of the organization managing the orphanage gave their consent and ethical approval Materials The interview sets were basically identical ... Childhood adversity, mental illhealth and aggressive behavior in an African orphanage: Changes in response to trauma-focused therapy and the implementation of a new instructional system Child and Adolescent ... hypotheses an alpha-level of a = 05 was used In cases of directional hypotheses, analyses were computed onetailed According to the completeness of datasets for t1 and t2, the analyses of the severity of...
- 9
- 405
- 0
Báo cáo y học: "Genetic analysis of the human infective trypanosome Trypanosoma brucei gambiense: chromosomal segregation, crossing over, and the construction of a genetic map" doc
Ngày tải lên :
14/08/2014, 20:22
... experiments, analyzed the data, and wrote the manuscript AC, LS, ATw, and LM carried out the experimental work All authors read and approved the final manuscript 14 15 16 Additional data files The following ... BLASTN search of the primers against the T brucei contigs database [55] The details of the primers used and the markers scored are provided as supplementary material (Additional data file 1) A ... genetic map of T b gam- Marker segregation proportions The availability of segregation data across the length of each chromosome allows a full analysis of the inheritance of the STIB 386 parental chromosome...
- 12
- 281
- 0
lepler - the many panics of 1837; people, politics, and the creation of a transatlantic financial crisis (2013)
Ngày tải lên :
01/11/2014, 12:16
... Crahan, Lew Bateman, Deborah Gershenowitz, Abigail Zorbaugh, Alison Daltroy, and Dana Bricken, and Sumitha Nithyanandan and her team at Integra Software Services David Lyons made good sense of ... History Faculty Seminar, and the Kompactseminar of Brandeis University and Universität Augsburg The libraries and librarians at UNH, Brandeis, Case Western, and the affiliated institutions of the Boston ... than half the value of America’s total exports.31 A diplomatic easing of Anglo-American trade relations in 1830 facilitated the importation of manufactured goods as well Growing American demand...
- 358
- 324
- 0
mallaby - more money than god; hedge funds and the making of a new elite (2010)
Ngày tải lên :
01/11/2014, 21:26
... Money T han God ALSO BY SEBASTIAN MALLABY The World’s Banker: A Story of Failed States, Financial Crises, and the Wealth and Poverty of Nations After Apartheid: The Future of South Africa MORE ... were the new Rockefellers, the new Carnegies, the new Vanderbilts They were the new American elite the latest act in the carnival of creativity and greed that powers the nation forward And what an ... egos made the most impact The story of hedge funds is the story of the frontiers of finance: of innovation and increasing leverage, of spectacular triumphs and humiliating falls, and of the debates...
- 497
- 380
- 0
Sea piracy and the formation of a regional response constructing asean maritime security from the strait of malacca anti piracy cooperation
Ngày tải lên :
30/09/2015, 10:12
... (2000), Hoadley and Ruland (2006), Lovell (2003), and Tan and Acharya (2004) Literature specifically dealing with maritime piracy is limited and standalone works on piracy in the Strait of Malacca perhaps ... Littoral States (Variable X) ASEAN-wide* (Variable Y) ASEAN Declaration on Japan Coast Guards 1997 Transnational Crime Meeting of Specialist Officials on 1998 Maritime Issues ASEAN Plan of Action ... prominently on ASEAN’s security agenda and ASEAN-related fora However, it can be claimed that should the maritime piracy concerns in the Strait of Malacca have been resolved via ASEAN-affiliated security...
- 129
- 531
- 0
The use of credit scoring models and the importance of a credit culture
Ngày tải lên :
04/10/2015, 10:26
... estimate annual and cumulative defaults 10 Marginal and Cumulative Mortality Rate Equation MMR(t) = Total value of defaulting debt in year (t) total value of the population at the start of the year ... Empresas ICA Sociedad Controladora Grupo Televisa SA Kimberly-Clark de Mexico Telefonos de Mexico SA de CV Vitro SA de CV n .a: not available BBBBB+ BB BB+ Dec 94 n .a AAA BBBABBB AA AAA AAA BB+ ... D AAA BBBBBBBB BBB ABB+ B+ BB BBBBBBBBBBBBAAA AAA BB+ A CCC BBB+ BB+ CCCCCC+ AAA AA BB+ BB+ D A B+ BBBB+ BB+ BB BBB+ BB+ BB BBBB+ BB+ BBBBAA A+ BB+ BB CCCB BB CCC B AABBB+ BB+ BB NR/NR/NR Ba2/NR/NR...
- 90
- 917
- 0
ON THE HALL EFFECT IN PARABOLIC QUANTUM WELLS WITH AN IN PLANE MAGNETIC FIELD IN THE PRESENCE OF a STRONG ELECTROMAGNETIC WAVE (LASER RADIATION)
Ngày tải lên :
31/10/2015, 10:41
... taking account of arbitrary transitions between the Landau levels The analytical result is numerically evaluated and graphed for a specific quantum well, GaAs/AlGaAs, to show clearly the dependence ... values of the HC at the maxima are much larger than other values By using the computational program we easily determine the position of the peak in each curve All the peaks correspond to the ωc2 ... 12], the magnetoresistance was derived in the presence of a strong EMW (laser field) for two cases: the magnetic field and the electric field of the EMW are perpendicular [11], and are parallel...
- 7
- 317
- 0