... symbols ofthe ‘crack baby’, ‘pregnant addict’ and ‘absent father’ emerged at the center of debate over fetal hazards (A more detailed analysis ofthesocial and political constructionof these ... presenting images of African–American women as virtual monsters, snorting cocaine on the way to the delivery room and abandoning horribly damaged babies in hospitals In some instances, drug use was ... Despite the fact that nearly every case challenged inthe courts has resulted inthe dismissal or acquittal of charges against women, prosecutors continue to bring criminal charges against women they...
... synthesize the N-terminal fragment ofthe poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC ... gene and 3¢ end ofa signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used Inthe second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers ... constructionofthe poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were...
... thinking of" ) contains a relevant option The second part ("and then you find") presents anew clinical finding, such as a physical sign, a pre-existing condition, an imaging study or a laboratory ... optimal use of information inthe context of these specific tasks, the test therefore provides an indication of clinical reasoning quality Clinicians find the test appealing because it contains cognitive ... particular format ofthe SCT and on the classification ofthe AJCC (American Joint Committee on Cancer) ofthe tested cancers Participation was voluntary Demographic data was collected for students and...
... to measure The factor causing the most in uence on the different backcrossing strategies inthe MAI breeding programme was the availability of genetically superior animals for the backcrossing ... shows the progress in FD, CFW and profit over the 15 years, starting in year ofthe breeding programme Year ofthe breeding programme is the first dot on the right At the beginning ofthe breeding ... a ecting performance of MAI programmes inthe case ofa situation concerning sheep breeding This study investigated two factors and their interactions that in uence the backcross generation of an...
... that can explain the pattern of displacement; rather, the displacement is associated with the zone of sympatry In Illinois and eastern Missouri, nearly all ofthe geographic change in dominant ... center black, rarely with weak2 orange lateral band black, rarely with weak2 orange lateral band black with orange lateral band black and orange lateral band Dominant call pitch (kHz) Pronotal extension ... recorded a continuous chorus sample along a 200 m woodside trail inthe Harold E Alexander Wildlife Management Area, Sharp County, Arkansas, while pointing the parabola/microphone assembly into the...
... needed are: a National Accounts, these being the natural source for a preliminary estimate of national aggregates If the - table is not incorporated inthe national accounts for the same year and ... accounts totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative ... separate blocks, without integrating them into a SAM as yet The computer retabulates the raw data from the surveys, data already available (e.g the 1-0 table) are scrutinized (e.g the treatment...
... design ofthe study, took part in collecting data, analysed data and was primarily responsible for writing the manuscript AB planned the design ofthe study, collected data and conducted the analyses, ... Petermann F: Frequency and comorbidity ofsocial phobia and social fears in adolescents Behav Res Ther 1999, 37:831-843 Ranta K, Kaltiala-Heino R, Rantanen P, Marttunen M: Social phobia in Finnish ... took part in reading the ms and approved to the final version ofthe ms TF developed the SPSQ-C, took part inthe preparation ofthe manuscript and made major contributions to the manuscript including...
... 一种文化空间的发现 THE CULTURAL CONSTRUCTIONOF NANYANG CHINESE COMMUNITY IN LATE QING AND EARLY REPUBLICAN CHINA: DISCOVERY OFA CULTURAL SPACE 薛 莉 清 XUE LIQING (B .A NANJING NORMAL UNIVERSITY) (M .A NATIONAL ... Chan Yuk Wah, "Ethnicity and capital: Changing Relations Between China and Southeast Asia", Journal of Contemporary Asia, vol.36, issue 3,(2006), pp.328-349 24 David Kenley, New Culture inaNew ... local dialects , asso ciati ons, rit uals and festivals and lit erature and arts) of Nan yang Chines e th at comb i ned th e cultural el ements of Sout hern China, Nan yang and th e West gradu all...
... the sources ofthe data and explains the underlying reasons to conduct quantitative analysis ofthe data with the qualitative analytical methodology of CDA The main purpose of quantitative findings ... culture? And finally, What a political stance is China trying to define toward the world? 1.2 Organization ofthe Thesis The thesis is organized into nine chapters It takes off, following the introductory ... identity inthe literature of bilingual advertising, pointing to its drawbacks and deficiency The final point ofthe critical review attends to the complexity of meaning construction within the particular...
... multimillion dollar campaign featuring a pop singer who had sung Taiwan’s national anthem during the presidential inauguration of Taiwan, because it was felt by the authorities of China that this advertisement ... literature of bilingualism research in advertising For example, Martin (2006) labels the appearance of visual images representing American culture in French advertising as “paralanguage code-mixing”; ... subjected to a quantitative analysis)8 All in all, in cases of an English word(s) being inserted into a slogan and/or a headline, whether or not the English language works as a master or authoritative...
... (re)presented inthe textual form of bilingual advertising Inthe following I start with the perception of advertising as asocial practice 3.1.1 Advertising as asocial phenomenon The language practice of ... code-switching as social practice The agency of bilinguals inthe very act of code-switching during social 69 interactions is related to, and largely shaped by, social practice that they may rely ... speakers for establishing, maintaining, or breaking down boundaries at a macro level as well as a micro level And an analysis of code-switching like this could discover the workings ofsocial and...
... Intrasentential 15 Total 174 78 Since the ways in which English is inserted into the domains of headline and slogan might be various, another quantitative examination was made to determine the ... gender and its social values are translated into the discourse of bilingual advertising, this study, then, takes as the source both the advertising of technology and beauty The incorporation of them ... mainly concentrates on lexical features of English words appeared inthe domains of headline and slogan that create a style of political activism distinguishing the community of China from others...
... an instance of intertextuality, the DIY frame bears more heavily on the cultural specialty of self-reliance inthe United States than that in China In an individualistic context of America the ... Company that has already been built up inthe INVITATION space is radically augmented A cross-space mapping further takes place between the DIY space and the INVITATION space Inthe blend diagrammed ... detailed information of contact details and promotion, its textual information is mainly situated inthe domains of headline and slogan Here is the slogan The power of dreams” and the headline 154...
... subject to a heterosexual male gaze With a male demographic intended inthe VIDEO-GAMING frame, an absent male gaze actually remains paramount in defining the girl climber as a sexual object Inthe ... modernity and its local meaning in China as a language of 211 high quality, the use of English is far more forceful than Chinese in presenting the aspects of female beauty ideal as the core ofthe headlines ... implication ofa disanalogy between the desirable effect ofthe Benefiance inthe YOUNG space and the concrete anxiety inthe OLD space A Disanalogy mapping takes place across these two spaces as inputs...
... of zhongguo dazhai is 261 reminiscent ofthe legendary status ofthe upper-class inthe feudal era of China The historical recalling naturally engenders the activation ofa collective imagination, ... rather a chain of reasoning that leads from the material affluence, family unity, and social prestige of an extended family as a primary social unit to broader consideration of values of national ... bilingual parallel My analysis as usual starts with the headline by focusing on its English part Inthe nominal compound Chinese villa, the mapping takes place between the mental spaces of CHINESE...
... and innovation are globally shared, some of them are locally particular insocial meaning English basically plays a predominant role in constructing all forms of modern identity, and an intersection ... surely cannot be taken as a transparent reflection of what the advertisers and the target audiences separately in designing an advertisement and in interpreting it Nevertheless, as a way of complementing ... media ofthe data are still fairly narrow in terms of diversity For example, beauty products that are traditionally classified as within the female domain of interest, such as cosmetics, skin care...
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R AAAAAAAAAA R R R R R R R R R R AAAAAAAAAAAAAAAAAAAAA ... concentrations indicated on each curve of K12 8A mutant GAPDH, K128E mutant GAPDH, R19 7A mutant GAPDH, and R197E mutant GAPDH In all plots, the arrow on the left indicates the beginning ofthe association ... association phase; the beginning ofthe dissociation phase is marked by the arrow on the right The experimental data were analyzed using global tting assuming a : interaction with BIAEVALUATION 3.1 Table...
... 269) Table Glycosaminoglycan analysis and calcium measurements ofthe water-soluble matrix, the EDTA-soluble matrix and the EDTA-insoluble matrix of Pinctada maxima nacre Sulfated and nonsulfated ... estimated by the Whiteman Alcian blue binding technique [28,29], using chondroitin sulfate as standard The assay was adapted to the estimation of GAG in more dilute samples by increasing the aliquot ... (6.5%) Thus, the alanine and glycine Fig Anion exchange-HPLC elution profiles ofthe water-soluble matrix (A) and the EDTA-soluble matrix (B) of Pinctada maxima nacre Samples (55 lL) containing 400...
... was used for the protein [39] A significant speed-up ofthe calculations was achieved by calculating pKa values for only a subset ofthe titratable groups inthe protein The subset of titratable ... [26,29] The pKa calculations indicate that Glu144 has a slightly elevated pKa inthe free enzyme that, at least in part, results from the vicinity of Asp215 (Table 3, rows and 4) The calculations indicate ... indicate that the pKa of Glu144 is further, and somewhat drastically, increased upon substrate-binding The D142N mutant is interesting because it retains significant activity (suggesting that a wildtype-like...