spectral fitting of indirect 1 h 13 c spectra

... H2 H3 H4 H1 H2 H3 H4 H5 H6 H6 ¢ NAc H1 H2 H3 H4 H5 H1 H2 H3 H4 H5 H6 H6 ¢ NAc H1 H2 H3 H4 H5 H1 H1 ¢ H2 H3 H4 H5 H6 H6 ¢ NAc 5 .19 3* 3.796* 4 .10 8* 5.885* 4.593 4.027 3.949 4 .17 6 3.996 4. 218 4.242 ... C2 C3 C4 C5 C6 C1 C2 C3 C4 C5 C6 CH3 C O C1 C2 C3 C4 C5 10 2.83 71. 54 67. 51 109. 41 147. 01 – 10 2.97 55.02 78.24 79.04 77. 41 63. 91 25.27 17 7.79 65. 61 74.58 73.04 82.89 76 .11 10 4.25 72.60 68.89 11 0 .11 ... signals fall within 0.02 p.p.m of Proton CS#604 (p.p.m.) CS#606 (p.p.m.) GalNAc (C) H1 H2 H3 H4 H5 H6 H6 ¢ CH3 H1 H2 H3 H4 H5 H1 H1 ¢ H2 H3 H4 H5 H6 H6 ¢ CH3 4.558* 3. 917 * 3.743 3.988* 3.967* 4.24...

Ngày tải lên: 16/03/2014, 14:20

... 2 .19 1. 93 2. 01 2 .16 1. 87 1. 90 15 4 15 5 15 4 15 7 14 6 17 4 16 5 15 8 14 8 13 9 13 9 16 7 14 8 16 7 17 3 17 2 16 2 13 8 14 5 16 4 15 6 14 6 17 0 16 4 x,y,z x +1, y,z x +1, y,z 1- x,y +1 ⁄ 2,-z x,y,z x,y,z x,y,z x,y,z x -1, y,z ... 3JHNCaH ¼ 9.8cos 2h 1. 1cosh +0.4sin 2h, where / ¼ |h 60|° for the / torsion angle around the C i -1 Ni–Cai C i bond sequence [23] and JHCaCbH ¼ 11 .0cos 2h )1. 4cosh +1. 6sin 2h for the h angle around the H Cai–Cbi H ... EM2OH) and Phe4OH proton (EM2OH) were not observed (–) H2 O Residue EM2 trans Phe3NH Phe4NH C- term.NH2 cis Phe3NH Phe4NH C- term.NH2 EM2OH trans Phe3NH Phe4NH cis Phe3NH Phe4NH Conformational characteristics...

Ngày tải lên: 30/03/2014, 20:20

Ngày tải lên: 07/03/2014, 23:20

Ngày tải lên: 08/03/2014, 00:20

... shown) The height distribution histogram indicated that the heights of the lower V-PPase protrusions (peak 1) were consistent with those of its cytosolic portions, whereas the heights of the higher ... vector pYES2 (Invitrogen, Carlsbad, CA, USA), 4390 and the two synthesized oligonucleotides Phis (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) and PMluI (5Â-GTACACGCG TCTGATCAG-3Â) ... SY, Hung SH & Pan RL (19 98) Subunit interaction of vacuolar H+ -pyrophosphatase as determined by high hydrostatic pressure Biochem J 3 31, 395402 11 Maeshima M (19 90) Oligomeric structure of H+ -translocating...

Ngày tải lên: 16/03/2014, 02:20

... and the rate of net glycogen synthesis, respectively 13 Glyc1 and 13 Glyc6 represent 13 Clabeled glycogen C1 and C6 concentration, and 13 Glc6P1 and 13 Glc6P6 represent 13 C- labeled glucose-6-phosphate ... d 13 Glyc6 Š ½D13 Glyc6 Š 13 Glyc6 Š ¼ 13 dt ffi 13 % 13 Glc6P1 Š d½ Glyc1 Š ½D Glyc1 Š 13 Glyc1 Š dt 13 Glc6P6 Š ð7Þ Eqn (7) implies that the initial rate of label incorporation into glycogen ... and the isotopic enrichment of Glc6P in terms of Vphos as: 13 Glc6P1 Š ðtÞ ¼ ½Glc6PŠ d 13 Glyc1 Š 13 Glyc1 Š ðtÞ ðtÞ þ Vphos Á ½GlycŠ dt ð4Þ Vnet þ Vphos 13 Glc6P6 Š ðtÞ ¼ ½Glc6PŠ d 13 Glyc6...

Ngày tải lên: 17/03/2014, 17:20

Ngày tải lên: 30/03/2014, 19:20

... in the regions (17 –34) and (55–84), respectively The occurrence of typical a helix encompassing these two RESULTS Circular dichroism CD spectra of the protein in 10 0% H2 O (Fig 1) are characteristic ... allowing the formation of the hydrophobic cluster that bring close to each other the first and second helices on one side, and the second and the third helices on the other side 2. 6H Tyr50 3. 5H Tyr50 ... French programs REFERENCES Emermann, H (19 96) HIV -1 and the cell cycle Curr Biol 6, 10 96 11 03 Connor, R.I., Chen, B.K., Choe, S & Landau, N.R (19 95) Vpr is required for efficient replication of human...

Ngày tải lên: 31/03/2014, 23:20

... http://www.virologyj.com/content/4 /1/ 89 10 11 12 13 14 15 16 17 18 19 20 Competing interests The author(s) declare that they have no competing interests 21 Acknowledgements 22 This work was supported by NIH grant ... dicistronic chimeric RNA which contains the gene encoding for neomycin phosphotransferase downstream of the HCV IRES The second cistern in the same RNA contains EMCV-IRES sequences for efficient ... translation of HCV non-structural proteins and this chimeric RNA terminates with the HCV 3'UTR This sub-genomic clone has adaptive mutation S 117 9I that allows high level replication of RNA in Huh-7 cells...

Ngày tải lên: 18/06/2014, 18:20

... 639 10 11 1 014 2099 (B-R5) 210 1 (B-X4/R5) 30 41 (C- R5) 54 41 (C- X4) MAGI-CXCR4 10 000 5000 No of blue cells 21 23 9 13 23 1 11 16 - 10 000 Phenotype from MT-2 No of blue cells 99 92 18 12 30 31 65 ... Coreceptor usage by HIV -1 subtype C chimeras in U373-MAGI-CCR5 and U373-MAGI-CXCR4 cell lines MAGI-CCR5 Infection counts → 5000 CHIMERA_ 17 1 17 3 18 2 18 3 221A 282 284 3 31 334 452 512 514 639 10 11 ... envelope gp120 interacts with CD4 receptor and CXCR4 or CCR5 coreceptor [10 -13 ] on T lymphocytes, monocytes/macrophages and other cell types [11 ,14 ,15 ] to enter target cells Analysis of env gp120 sequences...

Ngày tải lên: 18/06/2014, 18:20

... policies and procedures noncompliance with policies and procedures… what to do???? This is trial version www.adultpdf.com Policies and Procedures Noncompliance with or inadequacies would ordinarily ... Conclusion  The adequacy of the OIG’s policies and procedures are evaluated in Appendix A  If reviewer concludes that the financial audit met professional standards, but… inadequate policies ... This is trial version www.adultpdf.com Policies and Procedures Did OIG follow: checklists independent referencer other quality controls procedures This is trial version www.adultpdf.com Conclusion...

Ngày tải lên: 19/06/2014, 15:20

... 639 10 11 1 014 2099 (B-R5) 210 1 (B-X4/R5) 30 41 (C- R5) 54 41 (C- X4) MAGI-CXCR4 10 000 5000 No of blue cells 21 23 9 13 23 1 11 16 - 10 000 Phenotype from MT-2 No of blue cells 99 92 18 12 30 31 65 ... Coreceptor usage by HIV -1 subtype C chimeras in U373-MAGI-CCR5 and U373-MAGI-CXCR4 cell lines MAGI-CCR5 Infection counts → 5000 CHIMERA_ 17 1 17 3 18 2 18 3 221A 282 284 3 31 334 452 512 514 639 10 11 ... envelope gp120 interacts with CD4 receptor and CXCR4 or CCR5 coreceptor [10 -13 ] on T lymphocytes, monocytes/macrophages and other cell types [11 ,14 ,15 ] to enter target cells Analysis of env gp120 sequences...

Ngày tải lên: 20/06/2014, 01:20

... fighter, too, and I heard my Aunt Villa say, when I was a little girl, that he had the blackest, brightest eyes, and that the way he looked was like an eagle He'd fought duels, too, the way they ... say he was going to shoot himself back of the laundry if you turned him down?" "I didn't give him a chance," Saxon confessed "Anyway Del Hancock and Aunt Sadie got married next day And they were ... Finally, he couldn't stand it any more Ha rode up that night on horseback, wild as could be 'Sadie,' he said, 'if you don't promise to marry me to-morrow, I'll shoot myself to-night right back of the...

Ngày tải lên: 06/07/2014, 00:21

... transference of the care of his estates to him, and that was the apparent encouragement which both he and Lady Caroom gave to the friendship between Sybil and himself They had lunched with him twice ... Brooks, convinced of their folly, finally discarded certain uncomfortable thoughts which once or twice lately had troubled him He dined at Enton that night, and improved his acquaintance with Lady Caroom ... Caroom and her daughter, who were still staying there Although this was not a matter which he had mentioned to Mr Ascough, there was something which he found more inexplicable even than Lord Arranmore's...

Ngày tải lên: 06/07/2014, 02:20

... Moderate High Moderate High Moderate High High High High High High High Moderate High Moderate High Moderate Requirements Process control Process variance High High High Moderate High Moderate High High ... Changes in the length of the metal cylinder cause changes in the cavity length, which produce a linear change in the phase difference of the reflected light waves The sensor was tested in an accelerated ... silver chromate was converted to silver chloride, which increased the amount of light that reflected back into the fiber Thus the light output from the sensor increased in the presence of chloride...

Ngày tải lên: 05/08/2014, 09:20

... Moderate High Moderate High Moderate High High High High High High High Moderate High Moderate High Moderate Requirements Process control Process variance High High High Moderate High Moderate High High ... Changes in the length of the metal cylinder cause changes in the cavity length, which produce a linear change in the phase difference of the reflected light waves The sensor was tested in an accelerated ... silver chromate was converted to silver chloride, which increased the amount of light that reflected back into the fiber Thus the light output from the sensor increased in the presence of chloride...

Ngày tải lên: 05/08/2014, 09:20

... and synthetic oils Copyright © 19 83 CRC Press LLC 3 01- 315 4 /10 /06 12 : 51 PM 312 Page 312 CRC Handbook of Lubrication 11 Phosphosulfurized Pinene Variations — R is derived from either alpha or beta ... alkenyl succinic anhydrides and acids are then reacted with polyamines Copyright © 19 83 CRC Press LLC 3 01- 315 4 /10 /06 314 12 : 51 PM Page 314 CRC Handbook of Lubrication Applications — Dispersants ... boundary lubrication, surface asperities contact each other even though the lubricant supports much of the load Friction depends mainly on the shearing forces necessary to cleave these adhering asperities...

Ngày tải lên: 05/08/2014, 09:20

... and synthetic oils Copyright © 19 83 CRC Press LLC 3 01- 315 4 /10 /06 12 : 51 PM 312 Page 312 CRC Handbook of Lubrication 11 Phosphosulfurized Pinene Variations — R is derived from either alpha or beta ... alkenyl succinic anhydrides and acids are then reacted with polyamines Copyright © 19 83 CRC Press LLC 3 01- 315 4 /10 /06 314 12 : 51 PM Page 314 CRC Handbook of Lubrication Applications — Dispersants ... boundary lubrication, surface asperities contact each other even though the lubricant supports much of the load Friction depends mainly on the shearing forces necessary to cleave these adhering asperities...

Ngày tải lên: 05/08/2014, 09:20

... 19 95, 10 : 12 09 -12 16 25 O’Hagan RC, Tozer RG, Symons M, McCormick F, Hassell JA: The activity of the Ets transcription factor PEA3 is regulated by two distinct MAPK cascades Oncogene 19 96, 13 :13 2 313 33 ... in human chondrocytes J Biol Chem 19 96, 2 71: 23577-235 81 Mengshol JA, Vincenti MP, Coon CI, Barchowsky A, Brinckerhoff CE: Interleukin -1 induction of collagenase (matrix metalloproteinase 13 ) ... In the twenty-first century, the era of molecular medicine will surely include strategies targeted at the control MMP gene transcription 10 11 12 13 14 15 16 17 18 Acknowledgements The authors...

Ngày tải lên: 09/08/2014, 03:24