solar power is it wrong to call it a bright idea

simpson - what we could have done with the money; 50 ways to spend the trillion dollars we've spent on iraq (2008)

simpson - what we could have done with the money; 50 ways to spend the trillion dollars we've spent on iraq (2008)

... Here’s a thought: back in the early days of the current presidential campaign, there was a bit of flap about Barack Obama not wearing an American flag pin in his lapel His response was that patriotism ... of opposing teams actually getting along with each other To see a Cardinals fan passing a bag of peanuts to someone in a Reds cap, to watch as a Dodgers fan lets a Giants fan go ahead of him in ... technically be part of Canada, but there are advantages to that As Canadian citizens, they wouldn’t be able to vote in American elections, for example, so we’d never wake up one day to find S WHAT...

Ngày tải lên: 04/11/2014, 05:44

125 380 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_1 docx

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_1 docx

... – broadcast material; – video and audio tapes; – original literary, dramatic musical or artistic works Qualification The Act is limited in its effects to the UK (and colonies to which it may be ... as a matter of courtesy It may also save legal and publishing problems later Fair dealing This is the exception, to permission to copy, and applies where the material used is not a substantial ... own-brand cola It was alleged that confusion was being caused to customers wishing to purchase Coca-Cola because of the similarity Details of the law affecting lotteries and competitions are contained...

Ngày tải lên: 21/06/2014, 14:20

17 503 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_2 pot

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_2 pot

... and trade magazines, such as Ad-line, PR Week, Campaign or Photography Today, may also provide useful names and contacts, as may the Royal Photographic Society in London – which may also be able ... changes to text or design at this stage may incur extra charges, since additional work has to be carried out A whole page layout, design solution or display layout may have to be scrapped and ... use of any available ‘still’ material, plus a bit of location work and a reasonable ‘voice over’, the cost can be kept to a reasonable level What, then, can be described as ‘reasonable’? A rule...

Ngày tải lên: 21/06/2014, 14:20

17 433 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_3 doc

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_3 doc

... relations – a practical guide The client is normally invited to this preview to see the finished work and to give approval At this stage, minor alterations can still be made if necessary Packaging ... evening, to a series of parties, a full-blown dinner with speeches, an awards presentation, tours and visits, and sometimes a separate programme for delegates’ partners This might be a day trip to a ... venue; arrangements for all publicity and promotion; inviting potential exhibitors to participate; providing the contractors’ manual; arranging the exhibition hall layout and the provision of stand...

Ngày tải lên: 21/06/2014, 14:20

17 411 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_5 docx

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_5 docx

... Crisis management is the ability to cope, with any emergency situation that may arise in such a way that the minimum amount of ‘damage’ is caused to the organization – in whatever context that ... Prepare Earmark suitable premises as a crisis operations centre and appoint key staff; allocate their tasks and responsibilities Good communications are vital in any crisis situation, so look at ... dealing with it well, is the key It can be done, and done in such a way as to turn the situation to advantage; at the very least to limit any damage to a minimum What follows are some of the basic...

Ngày tải lên: 21/06/2014, 14:20

17 453 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_6 doc

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_6 doc

... indicative Analysis The analyst (that is the PRO) then has to examine all the material collected, analysing and classifying it so that a report can be drawn up and presented to management A ‘source’ ... aware of, understand and agree to abide by this Code, any amendment to it, and any other codes which shall be incorporated into it; remain up to date with the content and recommendations of any ... complaints; ideas and suggestions; reports and recommendations; newspaper cuttings – whether qualitative or quantitative; broadcast media monitoring (as above); books, articles and features; parliamentary...

Ngày tải lên: 21/06/2014, 14:20

17 458 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_7 ppt

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_7 ppt

... possibility of new business contracts it is always safer to make it clear that any such correspondence or discussions are ‘subject to contract’ Otherwise situations can arise through misunderstanding, ... misunderstanding, when a verbal contract is to be assumed without any formal document being drawn up This can prove to be embarrassing, expensive and can lead to litigation What makes a contract? Three components ... special factors, which are also applied by other professional advisers, shall have regard to all the circumstances of the specific situation, and in particular to: (a) the complexity of the issue,...

Ngày tải lên: 21/06/2014, 14:20

17 471 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_8 pdf

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_8 pdf

... writing reports, it is useful to have a standard reference numbering system for all paragraphs and sub-paragraphs for ease of quick reference Thus: Paragraph 1.1 sub-paragraph 1.1.1 sub-sub-paragraph ... have told them A written report must always be: l l l l l l Acceptable – that is to say, well presented Easily understood – use short sentences and paragraphs Avoid jargon – or at least explain it ... employment and has a lesser standard of care towards the contractor with regard to health and safety, both under common law and statute law Economic implications A self-employed person is responsible...

Ngày tải lên: 21/06/2014, 14:20

17 457 0
Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_9 doc

Online Public Relations A Practical Guide to Developing an Online Strategy in the World of Social Media PR in Practice by David Phillips and Philip Young_9 doc

... that deadlines vary between newspapers, TV and radio stations l Community relations – watch this aspect It could be a vital factor in the credibility battle l Expert advice – have expert advise ... record’ to the press l Compensation – not reveal details of any compensation to the media For insurance claims take advertising space in newspapers l Crank calls and letters – ignore all crank calls ... a crisis always remember Commitment Filing system The team Credibility Clean up Advertising Local press The local community The secretariat Information provision Training Management backing is...

Ngày tải lên: 21/06/2014, 14:20

8 342 0
progression of music from the 1940 s to the present

progression of music from the 1940 s to the present

... revolutionized disco and transformed it to todays techno Synthesizers are insteruments usually in a piano format that can manipulate sounds into any desired fashion The 80's also brought around many teen ... Rock & Roll is alive When the mid 70's rolled around type of rock became popular This new type included Cooper and AeroSmith The new rock had a punkish and always put on large extravagant concerts ... could be heard everywhere At the head of this British invasion was a group known as "The Beatles" There hits like "I want to hold your hand" They broke up in 1970 and all pursued solo careers or...

Ngày tải lên: 21/03/2014, 22:49

3 298 0
Anh văn lớp 7 - Unit seven: The world of work. B/ The worker. ( B1 ) pdf

Anh văn lớp 7 - Unit seven: The world of work. B/ The worker. ( B1 ) pdf

... a week -He is a machanic He repairs machines in a factory -He works about 40 hours a week ( Can compare with own answers ) -The John family always goes to Florida on vacation They have a great ... a week/ -My Dad/ machanic/ repair/ a Then you speak the sentences that factory/ you have just done -golf/ free time/ -go to florida/ vacation Write them on the board Ask them to speak and write ... words and read them Ask the students to read the letter and answer the questions: Answer the questions: What is his mother’s job? What does his Dad in a - His mother is a housewife factory? - What...

Ngày tải lên: 03/07/2014, 16:22

4 2,3K 1
Anh văn lớp 7 - Unit seven: The world of work. B/ The worker. (B 2 + B3) docx

Anh văn lớp 7 - Unit seven: The world of work. B/ The worker. (B 2 + B3) docx

... He is a farmer He works in the This is Hoa’s father What does he fields do? Where does he work? What is this? This is a buffalo Listen to teacher and read it Read the text and guide students to ... to read Ask them to read the text Go around the class and help them to read Call some students to read the text Listen to students and correct their mistakes Practice in front of the class Give ... the part b1 Read again the text is in the page 3, Practice and answer again the questions about 76 and answer the questions about Tim’s father.( Or look at the answers Mr John that they answered)...

Ngày tải lên: 03/07/2014, 16:22

4 4,2K 2
Anh văn lớp 7 - Unit seven: The world of work. B/ The worker. ( B4+ B5 ) pps

Anh văn lớp 7 - Unit seven: The world of work. B/ The worker. ( B4+ B5 ) pps

... -How many hours a week does he work? -What’s about his vacation? 2, Presentation @ Now you listen to the tape and take notes Listen to the teacher about the aim of Explain the aim of this listening: ... Repeat these works -hours per week -amount of vacation Listen to the tape Play the tape once Play it twice Each student talks the sentences that Call some students talk about each he/ she has ... she has just heard person and ask him or her fill out Others compare with their friends into the form that is on the board Listen again and check into the Ask students to compare with their notebooks...

Ngày tải lên: 03/07/2014, 16:22

5 817 1
Báo cáo y học: "Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population" ppsx

Báo cáo y học: "Survivors of war in the Northern Kosovo (II): baseline clinical and functional assessment and lasting effects on the health of a vulnerable population" ppsx

... Science (AAAS) Science and Human Rights Program, American Bar Association (ABA) Central and East European Law Initiative (Eds.): Political Killings in Kosova/Kosovo, MarchJune 1999: A cooperative ... Central and East European law initiative of the American Bar Association and the Science and Human Rights Program of the American Association for the Advancement of Science Washington DC: ABA Central ... analyses were carried out with handgrip strength as a dependent variable and a set of anthropometric variables as independent variables Ethical evaluation The Declaration of Helsinki and Danish...

Ngày tải lên: 13/08/2014, 14:20

13 321 0
HIPAA Privacy Rule Accounting of Disclosures Under the Health Information Technology for Economic and Clinical Health Act potx

HIPAA Privacy Rule Accounting of Disclosures Under the Health Information Technology for Economic and Clinical Health Act potx

... note that an access log also may commonly be referred to as an ‘‘audit trail’’ or ‘‘audit log’’ and an access report is similar to an ‘‘audit report.’’ We not use the terms audit trail or audit log ... report in a readable hard copy form For purposes of this paragraph, machine readable data is digital information stored in a standard format enabling the information to be processed and analyzed by ... 13563 and 12866 direct agencies to assess all costs and benefits of available regulatory alternatives and, if regulation is necessary, to select regulatory approaches that maximize net benefits...

Ngày tải lên: 06/03/2014, 15:20

25 592 0
Always On, Always Connected Finding Growth Opportunities in an Era of Hypermobile Consumers The 2012 Accenture Consumer Electronics Products and Services Usage Report pdf

Always On, Always Connected Finding Growth Opportunities in an Era of Hypermobile Consumers The 2012 Accenture Consumer Electronics Products and Services Usage Report pdf

... to start than a desktop or laptop 18% 16% Is easy to use for the whole family 15% Is more fun to use than a desktop/laptop Is less expensive than a desktop/laptop 9% Enables you to use more apps ... Motivations for Purchasing a Tablet Computer What main reasons have motivated/are motivating your choice to purchase a tablet computer? 58% Is more portable than a laptop Is the latest innovation in consumer ... 45% 57% 60% 61% Japan Germany China Sweden France United States Average Russia India South Africa Brazil Mainly personal Sample base: Respondents owning or planning to purchase a tablet PC in the...

Ngày tải lên: 07/03/2014, 10:20

21 412 0
Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

Báo cáo khoa học: Structural features in the C-terminal region of the Sinorhizobium meliloti RmInt1 group II intron-encoded protein contribute to its maturase and intron ppt

... dried and quantified with Quantity One software package (Bio-Rad Laboratories) Acknowledgements ´ We would like to thank Ascension Martos Tejera ´ and Vicenta Millan Casamayor for their technical ... check top-strand cleavage Single-stranded DNA substrate (ssDNA70) was obtained by labeling 100 pmol of HPLC-purified primer WT (5¢-AATTGATCCCGCCCG CCTCGTTTTCATCGATGAGACCTGGACGAAGACGA ACATGGCGCCGCTGCGGGGC-3¢) ... CCCGCACCAGCTTTCGCAAGA-3¢) were used to generate the upstream 824 bp fragment; a 5¢ end primer A4 00V ⁄ UP (5¢-GAAAGCTGGTGCGGGAAAATCCGG G-3¢) and a 3¢ end primer mut DN (5¢-GCGCGCGTAAT ACGACTCAC-3¢)...

Ngày tải lên: 15/03/2014, 09:20

11 398 0
Principles of Endowment Management - The seven key issues facing trustees and financial officers pptx

Principles of Endowment Management - The seven key issues facing trustees and financial officers pptx

... is larger than the market can absorb without systematically act a little paranoid, continually asking, causing distortions If a large position is placed on sale “What can go wrong? ” all at once, ... There is no way around it and 10% on a 25-year table; it s easily calculable – you There may be a way around it for A, but if A can beat probably end up with barely 60% of the final value of the market ... options as its volatility, which can be calibrated servative investment bias By court and futures, venture capital, private statistically This statistic, called a ruling, common stock was deemed placement,...

Ngày tải lên: 23/03/2014, 23:21

52 540 0
Báo cáo khoa học: Modular metabolic control analysis of large responses The general case for two modules and one linking intermediate docx

Báo cáo khoa học: Modular metabolic control analysis of large responses The general case for two modules and one linking intermediate docx

... sensitivity of response of a steady-state variable, w (usually metabolite concentration, S, or flux, J) to a 190 large change in a parameter, pi, from an initial state o to a final state f, is quantified ... modular approach to large metabolic responses A central issue to solving many biotechnological and biomedical problems is to assess how to modulate a metabolic system in order to obtain a pre-established ... order to change a variable in a desirable way, or to speculate about possible sites at which cell physiology operates to modify the variables, when adapting to different conditions All the quantities...

Ngày tải lên: 30/03/2014, 10:20

14 312 0
w