social construction of a hate crime epidemic

... accounts totals Finally, a SAM always has a matrix format 72 because of its emphasis on the identification of source and use of all transactions Summarizing, a SAM in our view serves as an alternative ... that a SAM is meant to fit into the existing national statistical and planning infrastructure That is to say that, first, a SAM is typically built on the basis of data which are already available ... current account of the national balance of payments (in case of a surplus this amount appears with a negative sign); from national institutions capital account: \ purchases of existing non-financial...

Ngày tải lên: 06/03/2014, 21:20

... symbols of the ‘crack baby’, ‘pregnant addict’ and ‘absent father’ emerged at the center of debate over fetal hazards (A more detailed analysis of the social and political construction of these ... idea of individual causality in discussions of fetal harm Social constructions of maternity and paternity In Western industrial cultures, notions of masculinity have been historically associated ... public health advertisement displays an image of a pregnant woman holding a drink and warns, A pregnant woman never drinks alone’ (N.J Perinatal Cooperative, 1993) Yet a pregnant woman also never...

Ngày tải lên: 01/11/2013, 08:20

... a tremendous amount of memory With 50,000 nouns, we would initially require a 50,000 x 50,000 array of values (or a triangular array of about half this size) With our current hardware, the largest ... looking at the nearest NP on each side of a particular NP Roark and Charniak (1998) built on that work by actually using conjunction and appositive data for noun clustering, as we here (They also ... phrase we can extract that Z is likely a hypernym for both X and Y This data is extracted from the parsed text, and for each noun we construct a vector of hypernyms, with a value of i if a word...

Ngày tải lên: 08/03/2014, 06:20

... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...

Ngày tải lên: 16/03/2014, 01:20

... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used...

Ngày tải lên: 30/03/2014, 13:20

... RE: MapChart: Software for the graphical presentation of linkage maps and QTLs J Hered 2002, 93:77-78 Fanarraga ML, Parraga M, Aloria K, del Mazo J, Avila J, Zabala JC: Regulated expression of ... that Placozoa are basal relative to all other non-Bilaterian animals ([70], but see [71]) Whole genome analysis of placozoan T adhaerens shows that the placozoan genome has the lowest amount of ... 14 additional markers were added at LOD = 2.5 After data partitioning by the Joinmap 4.0 program, the maternal (1:1 female type) and paternal (1:1 male type) datasets contained 167 and 155 markers,...

Ngày tải lên: 09/08/2014, 20:20

... Journal of Immune Based Therapies and Vaccines 2005, 3:4 Background Cutaneous T cell lymphoma (CTCL) is a malignant expansion of mature, clonal CD4 T cells with an affinity for epidermal localization ... the class I pathway for presentation to CD8 T cells Our simple approach to rapid DC vaccine construction takes advantage of both physical stimulation and production of apoptotic material providing ... white arrows) and c: merged image demonstrating internalization of apoptotic material in a class II positive cell A representative activated monocyte/DC is shown after CD4 column passage and recombination...

Ngày tải lên: 11/08/2014, 10:23

... maps based on a common set of clones reveal modes of chromosomal evolution in potato and tomato Genetics 1988, 120(4):1095-1103 Yamanaka S, Ikeda S, Imai A, Luan Y, Watanabe JA, Watanabe KN: Construction ... Natural variation of potato allene oxide synthase causes differential levels of jasmonates and pathogen resistance in Arabidopsis Planta 2008, 228(2):293-306 Oberhagemann P, Chatot-Balandras C, ... occurrence of each marker are given in Additional file and on the SGN database [37] QTL dataset for meta-analysis Table Number of publications, maps and QTLs collected to perform meta-analysis No of...

Ngày tải lên: 11/08/2014, 11:21

... Finnish varieties, 'Nolac' and 'Hankkijan-Venla', and the Canadian variety 'Tanila' Each population was a one-way pseudo-testcross of 94 individuals Marker Analysis Segregation data sets of RFLP, AFLP ... for Plants and Animals' program" References Sato S, Isobe S, Asamizu E, Ohmido N, Kataoka R, Nakamura Y, Kaneko T, Sakurai N, Okumura K, Klimenko I, Sasamoto S, Wada T, Watanabe A, Kohara M, Fujishiro ... Imaizumi-Anraku H, Bachmair A, Sandal N, Stougaard J, Murooka Y, Tabata S, Kawasaki S, Kawaguchi M, Harada K: Construction of a genetic linkage map of the model legume Lotus japonicus using an intraspecific...

Ngày tải lên: 12/08/2014, 03:20

... XbaIAgeIKGFPF 5HHribo2 CCGAATTCGTTAAATCCAAAAGCATACATATATCAATGATGC CCCGGGGCGGCCCCAAGGTCGAGAACTGAGTTG CCCGGGAGGAGTGACCGACTACTGCGTGAAGAAG GGTCTAGAGTATGATGCAGAAAATATTAAGG GAGCTCATGACTGCGGCTGCC GTTAACCAAGACTTCCTCTTCGGC ... AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI ... GTTAACCAAGACTTCCTCTTCGGC GGCGCGCCATTCCGGTATATAAA GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC...

Ngày tải lên: 12/08/2014, 04:20

... DNA-damage-inducible) alpha and beta, geminin, proliferating cell nuclear antigen, CDK6, and S-phase kinase associated protein isoform a; whilst SET translocation (myeloid leukemia-associated) is a multitasking ... residues that are near C-terminal basic residues The presence of additional basic residues at the N- or C-terminus of the target amino acid enhances the Vmax and Km of the phosphorylation reaction ... microarray-based comparison of ovarian tissues (theca cells, follicular granulose cells, total ovarian tissue, and ovarian connective tissue) from PCOS patients with ovarian tissues from healthy...

Ngày tải lên: 13/08/2014, 16:20

... mutation events and thus can only be considered an approximation, but they are comparable to a similar mutation rate reported in the malaria parasite Plasmodium falciparum of 0.00016 mutants/allele ... malaria parasite Plasmodium falciparum Science 1999, 286:1351-1353 Martinelli A, Hunt P, Fawcett R, Cravo PV, Walliker D, Carter R: An AFLP-based genetic linkage map of Plasmodium chabaudi chabaudi ... are available with this paper Additional data file provides segregation data Additional data file provides a comparison with the physical and genetic maps of T b brucei for every chromosome Additional...

Ngày tải lên: 14/08/2014, 20:22

... special functionality of the molecules that are attached on silicon surfaces [2–4] The study of the direct and covalent attachment of organic molecules to Si surfaces has attracted a great deal of ... (secondary ion mass spectroscopy), XPS can provide vital elemental and chemical information, quantitative information, low sample damage and diverse application in surface and materials analysis, ... structures by stacking fault as well as the charge transfer from the Chapter adatom to the rest atom [98] Such charge transfer process makes the adatom and the rest atom act as electron acceptor and electron...

Ngày tải lên: 14/09/2015, 08:43

... supervisor, Associate Professor Lam Lap I have learned so much from his patiend guidance, warm encouragement and kindly help, which can never be fully expressed I also want to extend my thanks to all ... III Abstract Qiyuan Cihua 憩园词话(Ci Discourse of the Leisure Garden), written by Du Wenlan 杜文澜 in the late Qing Dynasty, reflects the social network of ci-poets in Zhejiang, Jiangsu and Hubei area ... teachers and staffs in the Department of Chinese Studies and Chinese Library, in appreciation of their kind assistance during the two years I would like to thank all my friends, with whom I had...

Ngày tải lên: 30/09/2015, 10:11

... gift of the gab or „the ability to talk‟ Lim and Ping sell a range of saltwater fish, and occasionally, a few freshwater fish Lim lives in Joo Chiat, and has a 23 year old daughter who majored ... market as part of Singapore‟s „heartland heritage‟ and as a social space for the community As a blogger who is deeply interested in history and heritage, what you think of this stance? Some hawkers, ... occupation(s) Number of years that informant has been hawking in this market Number of years that informant has been hawking in other markets (if applicable) Part Two: Building a hawking biography;...

Ngày tải lên: 01/10/2015, 17:26

... 4.4 Back stages of the drama 93 4.5 Dramas of conflict, exclusion, and asymmetry 95 Chapter Narratives of the vanishing marketplace 5.1 Framing the narratives of the disappearing marketplace 101 ... undergraduate, A/ P Roxana Waterson also fuelled my anthropological imagination and curiosity for diverse forms of social life and peoples She was an outstanding academic and teacher to me then, and ... Bedok Market 1.2 Crafting a meaning-centred approach to Bedok Market 1.3 Why an ethnography of a neighbourhood marketplace? 1.4 On sociality, performance, and social memory 1.4.1 Sociality 15...

Ngày tải lên: 01/10/2015, 17:26

... al., 1957:243) He advocates a substantive understanding of economic that interrogates the material acts of making of a living, and the ways through which humans adapt to the social and natural ... capitalize on a dramaturgical framework in their inquiries into a variety of marketplaces They engage „the materiality and sociality of marketplaces – i.e of public exchanges spatially situated‟ ... Market as a „market‟ in this sense Rather, Bedok Market is a „marketplace‟ – a space that encapsulates a localized set of social institutions, social actors, property rights, products, transactional...

Ngày tải lên: 01/10/2015, 17:27

... (accepting) accepting and negative and neutral expresssions: activation accompanied by in amygdala, evaluation of: hippocampus, Task performance: parahippocampal recognition of gyrus, medial type of emotion ... a greater family aggregation among probands of social phobia of the generalized subtype (16%) than among the relatives of the specific (6%) and normal (6%) participants A test of the degree of ... physical signs with imbalances in autonomic neurotransmission In this formulation, the physical complaints typical of social phobia, are associated with rapid release of catecholamines (noradrenaline,...

Ngày tải lên: 01/11/2013, 08:20

... treated as if originating in a scale of equal intervals This violates the basic postulates of the analysis of variance The relevant data should have been properly treated through some form of ... possibility that a cognitive factor À ‘‘bias,’’ if that is what it is À plays a causal role in social phobia Bias in this context, rather than referring to any activity characterizing social phobia, fits ... that of others is obviously (and frustratingly for any model 188 What Causes Social Phobia? relying on it) only accessible in a limited way, if at all Therefore, whatever we may hazard to say about...

Ngày tải lên: 01/11/2013, 08:20

... to consider social phobia not as a breakdown in social ability but as emerging out of a pattern of meaningful actions that constitute a means to an end Although not necessarily abnormal in themselves, ... how to analyze and make sense of the performance displayed by the participants As only theory can offer guidance, the definitions of social skills acquire a high practical importance In practice, ... through Social Skills Training? A roundabout way to probe the validity of the construct of social skills in social phobia would be to study what happens to it after a course of therapy (i.e social...

Ngày tải lên: 01/11/2013, 08:20