final-sketch of solution 2
... đầu) Total Variance Explained Fac- tor Initial Eigenvalues Extraction Sums of Squared Loadings Rotation Sums of Squared Loadings Total % of Variance Cumulative % Total % of Variance ... loading KMO and Bartlett's Test Kaiser-Meyer-Olkin Measure of Sampling Adequacy. ,723 Bartlett's Test of Sphericity Approx. Chi-Square 482,156 df 3,000 Sig. ,000 Total Variance ... Sig. ,000 Total Variance Explained Compo nent Initial Eigenvalues Extraction Sums of Squared Loadings Total % of Variance Cumulative % Total % of Variance Cumulative % 1 2,249 74,968 74,968...
Ngày tải lên: 24/01/2013, 10:50
sketch of solution ps1
... Durbin-Watson stat 1.549588 Prob(F-statistic) 0.000000 Inverted AR Roots .77 Khử tương quan bậc 2 Dependent Variable: LOG(GREENBEAN) Method: Least Squares Date: 07/09/12 Time: 20:16 Sample(adjusted): ... tương quan bậc cao hơn. Khử tự tương quan bậc 2 Dependent Variable: LOG(GREENBEAN) Method: Least Squares Date: 07/09/12 Time: 19:49 Sample(adjusted): 1990:03 1999:12 Included observations: ... 05/26/12 Time: 09:48 Sample: 499 5599 Included observations: 5101 White Heteroskedasticity-Consistent Standard Errors & Covariance Variable Coefficient Std. Error t-Statistic Prob. C -2012.981...
Ngày tải lên: 24/01/2013, 10:51
... A and B. Example 3. Find an optimal tour for Problem A and B with the following input data (the source a 4 and the sink a 11 for Problem A) : vertices a 1 a 2 a 3 a 4 a 5 a 6 a 7 a 8 ... Consider a complete graph G = (A, E) with vertex set A = {a 1 , a 2 , … , a n } and edge set E = A A. Each vertex a i ∈ A has a real number t i (i = 1, … , n), called the altitude of vertex a i . ... that a 4 ↔ 6, a 11 ↔ 12, so we have b = 6 and e = 12. vertices a 9 a 2 a 5 a 12 a 15 a 4 a 3 a 6 a 7 a 1 a 8 a 11 a 14 a 17 a 13 a 10 a 16 altitude 1 3 3 4 4 5 8 8 8 9 9 11...
Ngày tải lên: 14/03/2014, 13:20
... difficult and dangerous. Electrical torpedoes are also available for the defense of mountain passes, roadways and fortified positions on land. I am not aware that electricity was used at all in ... early summer of 1861 the Secretary of the Navy, the Governor of Virginia, the chairman of the Committee of Naval Affairs, and other prominent officials were asked by him to witness a trial and ... Thenceforward, the Bay of Mobile and adjacent waters became the chief scenes of torpedo operation. Genl. Maury stated that he had caused to be placed 180 in her channel and waterways, that they...
Ngày tải lên: 23/03/2014, 05:20
A Concise Biographical Sketch of William Penn pptx
... obtain food and raiment, and so managed as to have an occasional interview with him. It was not long after, that, laying aside his rapier and all ornamentation of dress, he appeared in the plain ... Biographical Sketch of William by Charles Evans 4 A Concise Biographical Sketch of William by Charles Evans The Project Gutenberg EBook of A Concise Biographical Sketch of William Penn, by Charles ... there appeared to be no accuser or accusation against him, and he was declared clear in open Court. [A] [Footnote A: The aspersion of the character of William Penn, and the charges brought against...
Ngày tải lên: 23/03/2014, 05:20
A Biographical Sketch of the Life and Character potx
... you that after awhile we had a nice sofa, (bought at auction, because it was cheap), and that at another time a small side-board was provided, in like manner, by that dear grandpa, who always did ... Louis can boast, and I am told it still has the largest circulation of any paper west of the Alleghany Mountains. As regards the character of your great-grandfather, he was a noble specimen of the ... mother had quite a nice little carriage, and a fine old gray horse, that would have appeared very respectable, if (as the stable boy said) the calves had not “chawed of his tail!” However, that was a...
Ngày tải lên: 23/03/2014, 05:20
Báo cáo khoa học: Inhibitory properties and solution structure of a potent Bowman–Birk protease inhibitor from lentil (Lens culinaris, L) seeds ppt
... Ragona L, Molinari H, Tava A & Zetta L (2003) Anticarcinogenic Bowman-Birk Inhibitor Isolated from Snail Medic Seeds (Medicago scutellata): Solution Structure and Analysis of Self Association ... distance data by dynamical simulated annealing from a random array of atoms. FEBS Lett 239, 129–136. 58 Yip P & Case DA (1989) A New Method for Refine- ment of Macromolecular Structures based ... generation of the solution struc- ture. Statistics for the total amount of experimental data are reported in Table 3. A simulated annealing (SA) procedure was used starting from a randomly generated...
Ngày tải lên: 23/03/2014, 10:21
COSMOS A SKETCH OR A PHYSICAL DESCRIPTION OF THE UNIVERSE ppt
... of animals. Isolated and social living plants and animals. The character of flora and fauna is not determined so much by the predominance of separate families, in certain parallels of latitude, ... struggle of man against the elements, or of nations against nations, do not admit of being p 50 based only on a 'rational foundation' that is to say, of being deduced from ideas alone. ... composition is capable of acquiring. All points relating to the accidental individualities, and the essential variations of the actual, whether in the form and arrangement of natural objects in...
Ngày tải lên: 28/03/2014, 20:20
Báo cáo khoa học: Functional aspects of the solution structure and dynamics of PAF – a highly-stable antifungal protein from Penicillium chrysogenum pdf
... template PAF K 9A opafK9Ase GGAAAATGCACCGCTTCTAAGAACG pPic9Kmpaf opafK9Arev CGTTCTTAGAAGCGGTGCATTTTCC PAF K3 5A opafK35Ase GTTTGATAACAAGGCTTGCACCAAGG pPic9Kmpaf opafK35Arev CCTTGGTGCAAGCCTTGTTATCAAAC PAF K3 8A opafK38Ase ... CCTTGGTGCAAGCCTTGTTATCAAAC PAF K3 8A opafK38Ase GAAGTGCACCGCTGATAATAACAAATG pPic9Kmpaf opafK38Arev CATTTGTTATTATCAGCGGTGCACTTC PAF K35,3 8A opafK35,38Ase GTTTGATAACAAGGCTTGCACCGCTG pPic9KpafK3 8A opafK35,38Arev CAGCGGTGCAAGCCTTGTTATCAAAC PAF K9,35,3 8A opafK9Ase ... CAGCGGTGCAAGCCTTGTTATCAAAC PAF K9,35,3 8A opafK9Ase GGAAAATGCACCGCTTCTAAGAACG pPic9KpafK35,3 8A opafK9Arev CGTTCTTAGAAGCGGTGCATTTTCC Structure and dynamics of an antifungal protein G. Batta et al. 2884 FEBS...
Ngày tải lên: 29/03/2014, 23:20
Báo cáo Y học: Solution structure of a hydrophobic analogue of the winter flounder antifreeze protein doc
... chemical shift changes were Table 1. Sequence alignment of TTTT and VVVV2KE. 1 2 13 24 35 TTTT D TASDAAAAAAL TAANAKAAAEL TAANAAAAAAA TAR VVVV2KE D VASDAKAAAEL VAANAKAAAEL VAANAKAAAEA VARCONH 2 1260 ... resolution of all cross peaks. In particular, the chemical shifts of residues Glu11 and Ala14 were practically indistinguishable from those of Glu22 and Ala25 (Table 2). Yet, the appearance of the ... cells, and data were collected at 0 °CinanAn-60ti rotor (45 000 and 54 000 r.p.m.). Data were acquired as absorbance vs. radius scans (at 240 and 360 nm) at 0.001-cm intervals and as the sum of 10...
Ngày tải lên: 31/03/2014, 21:21
Báo cáo toán học: " Existence of solutions of a new system of generalized variational inequalities in Banach spaces" ppt
... oints of the nonexpansive mappings, 2 Existence of solutions of a new system of gener- alized variational inequalities in Banach spaces Somyot Plubtieng ∗ and Tipphawan Thammathiwat Department of ... 0 for all z ∈ K. The variational inequality has emerged as a fascinating and interesting branch of mathematical and engineering sciences with a wide range of applications in industry, finance, ... 1–21, 1994 35. Alber, Ya: Metric and Genernalized Projection Operators in Banach Space: Properties and Application. In: Kartsatos, A (ed.) Theory and Applications of Nonlinear Operators of Accretive and...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo hóa học: " Uniqueness of positive solutions to a class of semilinear elliptic equations" potx
... u(t, a) has a unique c ritical point c (a) in (a, b (a )), and at this point, u(t, a) obtains a local maximum value. Lemma 3.1 Assume that (F2) holds, then j(t, a) >0for all t Î (a, c (a) ). Proof. We ... slight modification to [8]. Lemma 3.2 Assume a Î N and f(t,u) satisfies (F1), then (H1) j(t ,a) vanishes at least once and at most finitely many times in (a, b (a) ), (H2) if 0< ;a 1 < ;a 2 , and at least ... for all t Î (a, t 0 ]. With the initial point t 0 replace by r >t 0 , for an appropriate value r, the same proof can be reapplied as often as necessary to give uniqueness of any con- tinuation...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " On existence and uniqueness of positive solutions to a class of fractional boundary value problems" pot
... fefi@dma.ulpgc. es Departamento de Matemáticas, Universidad de Las Palmas de Gran Canaria, Campus de Tafira Baja, 35017 Las Palmas de Gran Canaria, Spain Abstract The purpose of this paper is ... 2011:25 http://www.boundaryvalueproblems.com/content/2011/1/25 Page 8 of 9 RESEA R C H Open Access On existence and uniqueness of positive solutions to a class of fractional boundary value problems J Caballero * , J Harjani and K Sadarangani * Correspondence: ... article as: Caballero et al.: On existence and uniqueness of positive solutions to a class of fractional boundary value problems. Boundary Value Problems 2011 2011:25. Caballero et al. Boundary...
Ngày tải lên: 20/06/2014, 22:20
báo cáo hóa học: " On existence and uniqueness of positive solutions to a class of fractional boundary value problems" ppt
... fractional boundary value problems J Caballero * , J Harjani and K Sadarangani * Correspondence: fefi@dma.ulpgc. es Departamento de Matemáticas, Universidad de Las Palmas de Gran Canaria, Campus ... Tafira Baja, 35017 Las Palmas de Gran Canaria, Spain Abstract The purpose of this paper is to investigate the existence and uniqueness of positive solutions for the following fractional boundary ... a fixed-point theorem in partially ordered metric spaces. The autonomous case of this problem was studied in the paper [Zhao et al., Abs. Appl. Anal., to appear], but in Zhao et al. (to appear),...
Ngày tải lên: 21/06/2014, 00:20
Báo cáo hóa học: " Convergence theorems of solutions of a generalized variational inequality" doc
Ngày tải lên: 21/06/2014, 01:20
báo cáo hóa học: " Existence and multiplicity of positive solutions for a nonlocal differential equation" docx
Ngày tải lên: 21/06/2014, 02:20
Báo cáo hóa học: " Local existence and uniqueness of solutions of a degenerate parabolic system" pptx
Ngày tải lên: 21/06/2014, 03:20
Bạn có muốn tìm thêm với từ khóa: