simulation of a nuclear reactor

... described as travelling along localized ray paths (i.e approximately a straight line) Therefore, ray tracing can be used as a method for the simulation and approximation of radio wave propagation ... the appropriate electric field value The ray list contains all of the data about rays propagating from a base station to a field point Each field point has a ray list associated with it A ray ... Fitzpatrick As can be seen, it is passed a particular base station, an image and its order, and also the field point As seen earlier a ray is made up of nodes, two of these nodes are always the base...

Ngày tải lên: 20/11/2012, 11:36

... on a probe station Table lists major parameters of the device Only the ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a ... total sensing capacitance of 60fF Parasitic capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4 The capacitance ratios are derived from the ratios of driving ... capacitors, Cd is about an order of magnitude larger than Cd_air, so approximately the total gap capacitance is equal to the sum of Cm_air and Cd_air, which is close to the gap capacitance of...

Ngày tải lên: 27/10/2013, 23:15

... on a probe station Table lists major parameters of the device Only the ratio of parasitic capacitance and sensing capacitance can be measured, and the estimated value is calculated assuming a ... total sensing capacitance of 60fF Parasitic capacitance and mismatch of sensing capacitance is measured in a way as shown in Figure 5.4 The capacitance ratios are derived from the ratios of driving ... capacitors, Cd is about an order of magnitude larger than Cd_air, so approximately the total gap capacitance is equal to the sum of Cm_air and Cd_air, which is close to the gap capacitance of...

Ngày tải lên: 22/12/2013, 08:16

... 5¢-CCGTAAGGTCACAGGTCACTCG-3¢, DR2: 5¢-CCGTAAGGTCACAAGGTCACTCG-3¢, DR3: 5¢-CCG TAAGGTCACAGAGGTCACTCG-3¢, DR4: 5¢-CCGTAA GGTCACAGGAGGTCACTCG-3¢, DR5: 5¢-CCGTAAGG TCACCAGGAGGTCACTCG-3¢ PAL0: 5¢-CGCAAGGT CATGACCTCG-3¢ ... 5¢-ATTTCAGAAGTTGAAC AAACACAC-3¢, reverse primer: 5¢-AAGATGGTATT GAAGATGATGGTTGA-3¢), purified from agarose gel using Gel Extraction kit (Qiagen, Valencia, CA, USA) and randomly labeled with 32P using a Metaprime ... (Bio-Rad Laboratories, Hercules, CA 94547, USA) Primers specific for SmNR1 (forward: 5¢-AAAAACATCCCCCATTTCAGAA-3¢, reverse: 5¢-AACTACGCACATTCGGGTTGA-3¢) were designed by Primer Express Program TM (Applied...

Ngày tải lên: 07/03/2014, 11:20

... peptide-antibody recognition 11 Murata T, Fushinobu S, Nakajima M, Asami O, Sassa T, Wakagi T & Yamaguchi I (2002) Crystal structure of the liganded anti-gibberellin A4 antibody 4-B8(8) ⁄ E9 Fab fragment ... stage, the same protocol was applied by adding hydrogen bond restraints and dihedral angle restraints Additional NOE constraints were added in each round of calculations, and restraints that ... for v angles of serine residues The search ˚ area was set within 10 A of the centroid of heavy atoms of GA4 in the crystal structure Other calculation parameters were set to the default values...

Ngày tải lên: 16/03/2014, 23:20

... can span a lifetime of over 50 years Cash Flow Structure General for Projects initial cash outlay inflows from sale of product Particular to Forestry long term maintenance timed on-going outlays:thinnings, ...  Wood growth is measured by the MAI: Mean Annual Increment; ‘the annual increase in cubic meters of harvestable timber per hectare’  The MAI is influenced byrelevant rainfall, soil fertility, ... fire, pests and diseases, unsuitable species, collateral damage at harvest Forestry Risks  Timber return: inappropriate pruning and thinning, poor growth, timber usage and fashion changes  Sovereign...

Ngày tải lên: 23/03/2014, 04:20

... use of the automatic system based on active filtering From the analysis of the experimental data, in case of a nonlinear load of rectifier type, one may observe that there are different levels of ... controller Results obtained by numerical simulations The performance analysis of the system with active filtering was realized based on the data obtained by simulation in Matlab-Simulink environment ... ib [A] -10 10 ic [A] -10 a) b) Figure 6: Current waveforms of a nonlinear load represented by a controlled rectifier in case of a control angle equal with 30°, (a) and the harmonic spectrum of...

Ngày tải lên: 06/07/2014, 09:20

... dnuof saw ecnereffid tnacifingis oN slamina eht fo etats lacigoloib lareneg eht etaulave ot demrofrep saw sisylana lacilototameH aera lortnoc a morf dna stnalp rewop raelcun eht ot tnecajda smraf ... snoitarreba lamosomorhc decudni-yar -X fo srotacidni evitatitnauq sa ielcunorcim fo seicneuqerf eht fo esU TA najarataN ,I ciravejnuS ,A ohlamaR 81 378-368 ,95 ,1991 loiB taidaR J tnI egamad noitaidar ... aera na( aera lortnoc a ni elttac 51 dna )gnawggnoeY dna nijlU ,gnosloW( noitats rewop raelcun hcae morf yawa mk tuoba detacol smraf ni elttac evitan naeroK 53 morf deniatbo erew selpmas doolB...

Ngày tải lên: 07/08/2014, 20:23

... Nikhil Jagdish for his useful discussions and advices during the last two years The author is very grateful to Lakshmanan Kannan Anand Natara for his assistance and maintenance of LifeMOD software ... increase the levels of realism Especially, haptics has been investigated at length for medical education and surgical simulations, such as for surgical planning and laparoscopic surgical training ... devoid of muscles is validated against Panjabi et al (Panjabi et al., 1988, Panjabi et al., 1998) and colleagues’ experiments conducted using a bench-top trauma sled and isolated cervical spine...

Ngày tải lên: 10/09/2015, 15:50

... simulate the hybrid vehicle Comparison of simulation results obtained from the MATLAB/ADAMS simulation platform and ADVISOR will be presented Chapter will contain comparative analysis of hybrid and ... Activating Mechanical Brakes The brake constant for this model is arbitrarily set as 200Nm, and can be modified if additional test data are available Modeling the mechanical brake interface with ... range of each is selected and utilized Notable current hybrid vehicle manufacturers are Toyota, Honda, and Nissan Toyota and Nissan both utilize a combination of parallel and series hybrid architecture...

Ngày tải lên: 27/01/2016, 13:02

... each computational particle is tracked The calculations of momentum, mass and energy transfer for the particle phase are on the basis of computational particles, rather than real particles Applying ... Barracuda Virtual Reactor A case using a 243,423-cell grid and 419,506 computational particles is set as a base case The model is set to run for 100 s of simulation time to reach pseudo steady-state ... external surface area, and therefore the adiabatic wall setting becomes a more reasonable option than the prescribed temperature setting As shown in Table 2, the mean diameter of biomass particles...

Ngày tải lên: 01/08/2016, 09:31

... consumption rate, the airflow rate can be calculated using global mass balance of produced gas, total air, wet biomass and ash For a given input of gas flow rate at gasifier exit and airflow rate, Eq (3) for ... of magnitudes [6] Non-equilibrium approaches use char conversion as a surface phenomena describing by char reactivity and global reactions of char–gas and gas–gas reactions An effective global ... of CVs for analysis, where each CV has been characterized by the average values of parameters such as temperature, particle size, fluid flow rate, reactor diameter, etc In all CVs, the solid particles...

Ngày tải lên: 02/08/2016, 09:35

... 5¢-GCAGCAUCUUUAAUGAAUAdTdT-3¢ and 5¢-AUAAGUAAUUUCUACGACG dTdT-3¢; Nup358, 5¢-CCAGUCACUUACAAUUAAAd TdT-3¢ and 5¢-UUUAAUUGUAAGUGACUGGdTdT-3¢ (siNup358-1), 5¢-UGAAGCACAUGCUAUAAAAdTdT-3¢ and 5¢-UUUUAUAGCAUGUGCUUCAdTdT-3¢ ... (5¢-GATCTCCTCTTCAGCTA CCACCGCTTGAGAGACTTACTCTTGATTGTAACGA GGATA-3¢ and 5¢-AGCTTATCCTCGTTACAATCAA GAGTAAGTCTCTCAAGCGGTGGTAGCTGAAGAGG A- 3¢) were annealed and inserted into the BglII and HindIII sites of pEGFP-NLS ... localization of HDAC4 orchestrates muscle differentiation Nucleic Acids Res 29, 3439–3447 22 Yasuhara N, Shibazaki N, Tanaka S, Nagai M, Kamikawa Y, Oe S, Asally M, Kamachi Y, Kondoh H & Yoneda...

Ngày tải lên: 06/03/2014, 01:20

... ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG AGAAGAAACAATTACTTCTTAAGTCAATTAATTTTTCTAGAAATGCAAAAGATATTCCCC TTAACAGCTGTTTGAAATGAGGCCTCGGTCTCAAGTTTAAGAGTGCCCCCATATGTAAGC TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG ... A H V T L N V K S A * ATGCGAGGTCAGCATTTATCCAACCAGAAGCTTCACGGAGCTAGCTGGGCAAGGAAATTT GATAATCGCAAGAAATAATTTCCCCCCAAAAACAAAAGGTTGTTGGCTGAAAATACTTCT ACATGTACATGTATATCACTTTGAACTGGTTTTCATTAAAAAAAAAAAACCATCAATTTG ... TAAAAAGCTCCAGGAAGTTGACCCAGAAGAAATTTGTTAAGAGTTCACGGATAAGCAAGG TATTTGGATAAGGTGCATTTGTACATTTTGTGTGTACTGGTTTAGTGTAGAATTTAATTT TTTTTGGTTAATTCTGTCACAAGAACATAATTCTATGGTTACTACACAATGTTGCATCCC AACGCCACCTTTTTATTTTTAATCATATATCATCTCAGTGAAGGTCAGTCCTTG...

Ngày tải lên: 08/03/2014, 10:20

... (1035) 5.5- 6.3 46 Arkansas 5.4 ( 755) 5.0- 5.8 Maryland No data available Mississippi No data available Tennessee No data available Virginia No data available Wisconsin No data available Source: U.S ... operating, at seven plants (Appendix 4) No area of the U.S has as great a concentration of reactors The medical literature contains few studies of thyroid cancer incidence near U.S nuclear installations ... www.cancer.seer.gov Data covers states of CT, HI, IA, NM, and UT, and metropolitan areas of Atlanta, Detroit San Francisco, and Seattle (about 10% of U.S population) After 2002, SEER expanded...

Ngày tải lên: 15/03/2014, 01:20

... This band (arrow) had an apparent molecular mass of 115 kDa All other labeled bands visible in lane of Fig 6B (mainly corresponding to a size range of 45–60 kDa) were already detectable in the absence ... 5¢-ATAT GGAACGCTTCACGAATT-3¢ (U6-1) or 5¢-AATATGG AACGCTTCACGAATT-3¢ (U6-2) as downstream primer, respectively PCR fragments were purified by agarose gel electrophoresis and used for in vitro transcription ... close examination of the bands in lanes 2–4 of Fig 2A revealed that concomitant with increasing length of the UMP tails of the substrate RNA, a decreasing number of distinguishable labeled RNA products...

Ngày tải lên: 17/03/2014, 09:20

... pcDNA3.1-GST-Nur77 plasmid pSilencer-shNur77 was prepared by overlapping strategy with primers 5¢-gacGGATCCgcagtccagccatgctccttt caagagaaggagcatg-3¢ (with BamHI), 5¢-cggAAGCTTtATC GATccaaaaaacagtccagccatgctccttctcttg-3¢ ... 5¢-GACTCGCAGACAATGATGG TC-3¢ and 5¢-GCAAACTCATCATGGGCACC-3¢ The results were normalized with b-actin, for which the primers were 5¢-ATGGTGGGAATGGGTCAGAAG-3¢ and 5¢-CA CGCAGCTCATTGTAGAAGG-3¢ Another ... CCTCCAAAAAGCACACAGA-3¢ for St-182 and St-93/ -182, 5¢-AGAAATTATCATCTTTTCCAGTCCGAGA-3¢ for St-93 and St-93/-182, and 5¢-TGGTCTTGAACTCCT CGTGATCTGCCCA-3¢ for Lst-595 pcDNA3.1-Nur77 expression plasmid...

Ngày tải lên: 23/03/2014, 07:20

... for translation initiation, 5¢-(C ⁄ A) AA (A ⁄ C)ATG, and a putative poly (A) addition signal sequence, 5¢-AATAAA [17,18] It encoded a predicted product of 255 amino acids with a molecular mass of ... may be an artificial event Association of DmPCNA2 with Drosophila DNA polymerases d and e PCNA was originally identified as a DNA sliding clamp for DNA polymerases [22] In humans, PCNA associates ... reagents (Amersham Pharmacia Biotech, Piscataway, NJ) Animals were fed water and standard rabbit food and maintained on a 12 h light/dark cycle Polyclonal antiserum to the peptide was raised in rabbits...

Ngày tải lên: 23/03/2014, 10:20

... … TTCGACgtgagtaacagtgtc 74 bp (exon 6, 1431 bp) 2031 … AATAAATACTTGTGGAATATG Exon 5¢-splice site aaacgttatgtggccTGGGAG … 133 (exon 1, 234 bp) tcgtttgtattctagTTGCAG … 310 tggtatgtgtgtcagATGCTG ... analysis of the human genome Nature 409, 860–921 Kawai, J., Shinagawa, A. , Shibata, K., Yoshino, M., Itoh, M., Ishii, Y., Arakawa, T., Hara, A. , Fukunishi, Y., Konno, H., Adachi, J., Fukuda, S., Aizawa, ... Aizawa, K., Izawa, M., Nishi, K., Kiyosawa, H., Kondo, S., Yamanaka, I., Saito, T., Okazaki, Y., Gojobori, T., Bono, H., Kasukawa, T., Saito, R., Kadota, K., Matsuda, H., Ashburner, M., Batalov,...

Ngày tải lên: 23/03/2014, 21:20