... ASY, Celgene, Novartis, and Methylgene Authors' contributions GG, DM, and AY contributed equally to the content and focus of the manuscript from its earliest conception All authors read and approved ... Khorashad JS, Gabriel IH, Chaidos A, Olavarria E, Goldman JM, Apperley JF, Marin D: Pleural effusions in patients with chronic myeloid leukaemia treated with dasatinib may have an immune-mediated pathogenesis ... infiltration of pleural fluids and an association between effusions and immunemediated reactions, such as rash and autoimmune events [24,26] It has been suggested that dasatinib may inhibit the function...
Ngày tải lên: 10/08/2014, 22:20
... tamandua (Tamandua mexicana), the Sechuran fox (Pseudalopex sechurae), the puma (Puma concolor), the jaguar (Panthera onca), the ocelot (Leopardus pardalis) the tayra (Eira barbara), the collared ... Region Cajamarca from elevations between 1100-1500 m a. s.l (CisnerosHeredia et al 2008) We collected our specimens near Santa Rosa de la Yunga, Region Cajamarca, and in Zapatalgo, Region Amazonas ... Särkinen et al 2011, Venegas 2005) This ecoregion is home to a large number of vertebrates (e g Puma concolor, Tremarctos ornatus, Tamandua mexicana, Amazilia amazilia and Iguana iguana) with a high...
Ngày tải lên: 19/11/2015, 15:51
Impact Of Tariff Cuts On Pakistan: A Computable General Equilirium Analysis With Particular Focus On Main Exports And Regional Disparities
... Standard Industrial Classification Pakistan Standard Trade Classification Real Effective Exchange Rate Regional Equation Systems Rs SAM SAPs SBP Rupees Social Accounting Matrix Structural Adjustment ... patterns of association among Pakistan’s political and trade regimes, socioeconomic indicators, and regional conflicts and disparities It also makes a case for adding a regional dimension to the ... is as follows Chapter undertakes an analytical review of Pakistan’s political and trade regimes, socioeconomic indicators, and regional conflicts and disparities, and identifies apparent patterns...
Ngày tải lên: 12/12/2016, 20:23
PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx
... visual air quality and physical indicators such as color and contrast in a landscape Flachsbart and Phillips (1980) used physical data for a variety of air pollutants and weather indicators and, ... 401-405 Koushki P A, Al-Fadhala S, Al-Saleh O, and Aljassar A H 2002 Urban air pollution impact of modal shift in school transportation in Kuwait Journal of Urban Planning and Development 128(2): ... London: David And Charles, 173-191 McDonald J S, Hession M, Rickard A, Nieuwenhuijsen and Kendall M 2002 Air quality management in UK local authorities: public understanding and participation...
Ngày tải lên: 06/03/2014, 16:20
báo cáo sinh học:" Information needs of health care workers in developing countries: a literature review with a focus on Africa" doc
... problems with understanding and/ or implementation of international and/ or national guidelines The South Africa study, mentioned above, looked at national guidelines Also a review on India and diabetes, ... health worker's perceived and actual needs change with time, place and clinical caseload Needs vary also according to availability of diagnostic, treatment and referral facilities And they may ... churchowned primary health care facilities in Dar Es Salaam and other Tanzanian coast regions East Afr Med J 2001, 78(10):510-514 Ratanawijitrasin S, Soumerai SB, Weerasuriya K: Do national medicinal drug...
Ngày tải lên: 18/06/2014, 17:20
ICTs for e-EnvironmentGuidelines for Developing Countries, with a Focus on Climate Change pptx
... such as Las Vegas, forest loss in the Amazon, rapid oil and gas development in Wyoming and Canada, forest fires across sub-Saharan Africa and the decline of the Aral Sea in Central Asia and Lake ... conditions, planning may also include the anticipation of environmental conditions and emergency scenarios, such as climate change, man-made and natural disasters 4) Environmental management and ... Administration (NASA), National Oceanic and Atmospheric Administration (NOAA) and the European Space Agency (ESA); • The World Meteorological Organization (WMO); • United Nations Environment Programme...
Ngày tải lên: 28/06/2014, 12:20
Báo cáo y học: " Paratuberculosis control: a review with a focus on vaccination" ppt
... infection or vaccination with avian type mycobacteria and allows to rule out mammal tuberculosis infection according to standardized criteria An additional drawback to MAP vaccination, which at least ... field data suggest that vaccination of adult or subadult animals might have some management (no need for separate handling, vaccination of only replacers) and therapeutic (stronger humoral and cellular ... interest in MAP vaccination studies change among countries For example, early large studies in the UK and France, gave way to studies in The Netherlands, New Zealand, Australia and Spain This pattern...
Ngày tải lên: 11/08/2014, 08:21
Essays in modeling health care expenditures with a focus on singapore
... that of Japan and Sweden, while under-five mortality rate of Germany is 4, Australia 5, U.K 6, Canada and U.S What makes Singapore’s achievement laudable is that it has done so at a fraction of ... program for diabetes, hypertension and high blood cholesterol for people aged 55 years and above These conditions can lead to heart disease and stroke, the major causes of ill health and mortality ... are made in absence of any data which cast doubt on their reliability In fact, the lack of primary data has been an issue in Singapore case The paper by Chia and Tsui (2005) deserves a special...
Ngày tải lên: 10/09/2015, 15:53
Báo cáo y học: " Research How is the balance between protein synthesis and degradation achieved" ppt
... Kakazu Y, Sugawara K, Igarashi S, Harada S, Masuda T, Sugiyama N, Togashi T, Hasegawa M, Takai Y, Yugi K, Arakawa K, Iwata N, Toya Y, Nakayama Y, Nishioka T, Shimizu K, Mori H, Tomita M: Multiple ... processing mRNA nuclear membrane transport and localization mRNA initiation RIBOSOME elongation release protein activation active protein Figure The feedback regulation of protein synthesis Shown are events ... transcriptional regulation of protein synthesis, this would require that a particular concentration of a feedback agent bind to a regulatory protein with an avidity that produces a concentration...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "Primary lower limb lymphedema: a focus on its functional, social and emotional impac"
... family history of similar disorders A conventional approach was applied, involving elevation of the affected limb, massage, physical activity and compression with elastic stockings On physical ... lymphedema in a 33-year old female Discussion In the first case the analysis of SF-36 results disclosed a significant functional impairment with a slight impact of the condition on emotional and social ... dermatologists, may represent an essential issue for an optimal overall management of cases with a congenital primary lymphedema [14] Conclusions Assessing the impact of the duration and severity of the condition...
Ngày tải lên: 25/10/2012, 11:40
Tài liệu Sexual Coercion and Reproductive Health, A focus on Research doc
... Pan American Health Organization and the Organization of American States -recognized the gravity of gender-based abuse and passed resolutions condemning it A coalition of more than 900 international ... documented consequences of sexual abuse are early onset of sexual activity and an inability to distinguish sexual from affectionate behavior (Donaldson, Whalen and Anastas, 1989; Browne and Finkelhor, ... prostitution), sexually transmitted diseases (STDs), neonatal and maternal mortality and chronic pelvic pain In addition, there is a growing consensus among scholars, jurists and human rights activists...
Ngày tải lên: 13/02/2014, 10:20
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA ... ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelated GFP–CDS CDS CDS ... CCATGCCTATGATACTGGGAT-3¢ GSTM1-revA 5¢- CTAAAGATGAGACAGGCCTGG-3¢ GSTM1-revB 5¢-GATCCTAAAGATGAGACAGGCCTGG-3¢ GSTM2-forA 5¢-AATTCGATGCCTATGACACTGGGTTAC-3¢ GSTM2-forB 5¢- CGATGCCTATGACACTGGGTTAC-3¢...
Ngày tải lên: 31/03/2014, 15:20
báo cáo hóa học: " Shedding light on walking in the dark: the effects of reduced lighting on the gait of older adults with a higher-level gait disorder and controls" ppt
... over fall at least once each year [14] and among patients with a HLGD, falls are apparently much more frequent [9] Previous studies have demonstrated that impaired vision is an important and independent ... effects of an attention demanding task on the gait of healthy young and older adults [35,36] When healthy young or older adults are asked to walk and perform an additional task simultaneously, gait ... fear of falling that appears to be related to this increased stride variability, and have an increased risk of falls [8,9] Further, the extrapyramidal, limbic systems, and the frontal lobe apparently...
Ngày tải lên: 19/06/2014, 10:20
a study on backfire control and performance improvement by changing the valve timings in a hydrogen-fueled engine with external injection
... displacement as the timing gear moves The changing value of phasing angle for intake camshaft and exhaust camshaft is almost similar As a rough estimation, the cam phasing angle varies a value ... thermal efficiency as a function of fuel-air equivalence ratio 81 for equal energy compensation to a VOP 30CA Fig 4-19 Air mass flow rate as a function of EVC timing for naturally 84 aspirated and ... mass flow rate and COVimep as a function of VOP 71 Fig 4-10 Rapid burning and combustion duration as a function of the VOP 72 Fig 4-11 Air mass flow rate with change of the VOP for H2 and gasoline...
Ngày tải lên: 13/11/2014, 06:34
A study on idiomatic variants and synonymous idioms in english and vietnamese
... techniques such as comparison, transformation, and contrastive analysis are applied in a quick-minded and active way to find out a general picture about the idiomatic variants and synonymous idioms ... England and the US; meanwhile, such slang as asskissing (flattering, toadying), dinge (a black person) are accepted only by the American Finally, it is found that slang is fashionable and soon ... Character and appearance: as cold as ice - Children and babies: like a kid in a candy store - Clothes: at the drop of a hat - Colours: black and white - Death: at death’s door - Drinking and...
Ngày tải lên: 07/11/2012, 15:01
A STUDY ON GRAMMATICAL MEANS AND PROSODIC MEANS AS COHENSIVE DEVICES IN NARRATIVE DISCOURSE
... Halliday, M, and Hasan, R 1976 Cohesion in English New York: Longman Group Limited Halliday, M 1992 Spoken and Written language London: Eddward Arnorld Nunan, D 1993 Itroducing Discourse Analysic ... Tieng Anh o Nguoi Viet Hanoi: Information and Culture Publishing House O'Connor, J.D & G K Arnold 1973 Intonation of Colloquial English London: Longman O'Connor, J.D 1967 Better English Pronunciation ... to Discourse Analysis Harlow (Essex): Longman Crystal, D 1992 Introduction to Linguistics London: Penguin Georgakopoulou, A and Goutsos, D 1997 Discourse Analysis: An introduction Edinburgh:...
Ngày tải lên: 07/09/2013, 13:02
A study on group discussion and its impacts on speaking ability of the non major students at the post elementary level in military science academy
... that teachers should arrange situations in which a balance is made between “syntactic and lexical modes of communication” on one hand, while maintaining that balance between “conservative and ambitious ... study: research on group/pair work, research on task-based planning and research on criteria of fluency, complexity and accuracy The general review about group discussion and how it advantages students ... something and being able to something with that knowledge That is, learning a language as a natural human accomplishment involves not only language knowledge, knowledge about language, but also language...
Ngày tải lên: 07/09/2013, 13:02
FOCUS ON - phrasal verbs and can, could, will, and would
... tense stand around stand around & stands around -ing form past tense past participle standing around stood around stood around stand around p.v When you stand around, you stand in a place wasting ... to stop talking, but he went on and on and on and on go on p.v When an event or activity goes on, it continues The party went on until dawn I hate long meetings that go on for hours go on p.v When ... was created or started This table is very valuable It goes back to the 1760s The archeologist found ruins that go back 5,000 years hand over hand over & hands over handing over handed over handed...
Ngày tải lên: 01/11/2013, 12:20
FOCUS ON - phrasal verbs and midsentence adverbs
... catch on & catches on catching on caught on caught on catch on p.v When a fashion or habit becomes popular and is adopted by many people, it catches on When a product or service becomes popular ... comes about, it happens, usually as a result of a series of events and actions He was the richest man in town, and now he's bankrupt How did that come about? Several major medical advances have ... 256 34 FOCUS ON: pronunciation of two -and threeword phrasal verbs, As we saw in Sections and 6, phrasal verbs are sometimes accented on the verb and sometimes accented on the particle It might...
Ngày tải lên: 01/11/2013, 12:20
FOCUS ON - phrasal verbs and should and ought to
... disease went away immediately What did my disease do? 11 Sarah is cleaning up all the orange juice that she spilled on the floor What is Sarah doing? 12 Carlos always eats all his baby food, and ... now pay up pay up & pays up paying up paid up paid up pay up p.v When you pay up, you pay all the money you owe to a person, bank, and so on, usually as a result of pressure to pay the money A guy ... because no one knows or cares about it, you get away with it Jake has been cheating on his taxes for years, and he always gets away with it He got away with kilting his ex-wife even though everyone...
Ngày tải lên: 01/11/2013, 12:20