sialotropism and lymphotropism of hepatitis c virus

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

Tài liệu Báo cáo khoa học: Template requirements and binding of hepatitis C virus NS5B polymerase during in vitro RNA synthesis from the 3¢-end of virus minus-strand RNA docx

... CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT ... TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC...

Ngày tải lên: 20/02/2014, 01:20

15 598 0
Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

Báo cáo khoa học: " Thermal stability and inactivation of hepatitis C virus grown in cell culture" ppsx

... whether the presence of human blood affects the stability of HCVcc, a concentrated HCVcc stock was diluted in normal human serum to achieve a titer of 1.0 × 105 FFU/ml At RT, this HCVcc-containing serum ... presence of human serum does not seem to affect the susceptibility of HCVcc to heat treatment Effect of UVC light irradiation on HCVcc infectivity To examine the effect of continuous UVC light ... third cell passage) The decay rate of HCVcc infectivity after UVC light irradiation was calculated as 0.067-log/sec and 0.041-log/ sec, for HCVcc in culture medium (A) and human serum (B), respectively,...

Ngày tải lên: 12/08/2014, 04:21

12 411 0
Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

Báo cáo y học: "Sustained eradication of hepatitis C virus by low-dose long-term interferon therapy in a renal transplant recipient with dual infection with hepatitis B and C viruses: a case report" pptx

... 5:246 http://www.jmedicalcasereports.com/content/5/1/246 Page of Figure Clinical course of a renal transplant recipient infected with hepatitis B and C viruses (HBV and HCV, respectively) 1st yr~7th ... Journal of Medical Case Reports 2011, 5:246 http://www.jmedicalcasereports.com/content/5/1/246 Graduate Institute of Clinical Medical Sciences, Chang Gung University, College of Medicine, Taoyuan, ... N: Chronic hepatitis C virus infection in renal transplant: treatment and outcome Clin Transplant 2006, 20:677-683 Yen TH, Huang CC, Lin HH, Huang JY, Tian YC, Yang CW, Wu MS, Fang JT, Yu CC, Chiang...

Ngày tải lên: 10/08/2014, 23:21

4 283 0
Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot

Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot

... NH, Gerlach JT, Jung MC, Diepolder HM, Schirren CA, Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M, Cerny A, Pape GR: Association of hepatitis C virus- specific CD8+ T cells with ... Schraut WW, Zachoval R, Hoffmann R, Schirren CA, Santantonio T, Pape GR: Recurrence of hepatitis C virus after loss of virus- specific CD4(+) T-cell response in acute hepatitis C Gastroenterology ... hepatitis C virus after chemotherapy for colon cancer Clin Oncol (R Coll Radiol) 2004, 16:204-205 de Pree C, Giostra E, Galetto A, Perrin L, Zulian GB: Hepatitis C virus acute exacerbation during chemotherapy...

Ngày tải lên: 11/08/2014, 10:22

3 232 0
Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx

Báo cáo y học: " Mutations in the E2-PePHD region of hepatitis C virus genotype-3a and correlation with response to interferon and ribavirin combination therapy in Pakistani patients" pptx

... subjects and doctors for their cooperation in the study Authors’ contributions SA and MI conceived of the study participated in its design and coordination and gave a critical view of manuscript ... resulted in replacement of hydrophilic and basic amino acids with a neutral amino acid in rapid responders and replacement of a neutral amino acid with hydrophilic and basic amino acid in breakthrough ... using CLC workbench software http:// www.clcbio.com Amino acid composition was calculated using MEGA version 4.1 The subject is very controversial as some of the investigators reported a correlation...

Ngày tải lên: 11/08/2014, 21:21

5 254 0
Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps

Báo cáo y học: "Epidemiological manifestations of hepatitis C virus genotypes and its association with potential risk factors among Libyan patients" pps

... of hepatitis C virus genotypes Clin Microbiol Rev 2000, 13:223-235 20 Henquell C, Cartau C, Abergel A, et al: High prevalence of hepatitis C virus type in central France evidenced by a prospective ... Argentini C, et al: Molecular Epidemiology of Hepatitis C Virus Genotype Isolates in Egypt and Analysis of the Variability of Envelope Proteins E1 and E2 in Patients with Chronic Hepatitis J Clin Microbiol ... Laboratory and Clinical Evaluation of HCV Infection A serum specimen was collected from each patient and was tested positive for HCV antibody (Anti-HCV) using and 3rd generation commercial Enzyme...

Ngày tải lên: 12/08/2014, 02:20

7 257 0
Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

... MC, Diepolder HM, Schirren CA, Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M, et al.: Association of hepatitis C virus- specific CD8+ T cells with viral clearance in acute hepatitis ... inconsistencies in HLA associations with HCV infection The recognition and subsequent destruction of infected cells by natural killer (NK) cells and virus- specific cytolytic T lymphocytes (CTL) provide ... presenting cells or on infected cells such as hepatocytes CD8 or CD4 T cells can recognize the complex of HLA- class I peptides or class II peptides and act as either effector T cells, helper T cells,...

Ngày tải lên: 12/08/2014, 04:21

8 499 0
Báo cáo khoa học: " Conserved peptides within the E2 region of Hepatitis C virus induce humoral and cellular responses in goats" pptx

Báo cáo khoa học: " Conserved peptides within the E2 region of Hepatitis C virus induce humoral and cellular responses in goats" pptx

... vaccination against hepatitis C virus (HCV): effect of expressing different forms of HCV E2 protein and use of CpGoptimized vectors in mice Vaccine 2002, 20:3263-3271 Lechmann M, Liang TJ: Vaccine ... protected against acute HCV infection However, the majority of convalescent humans are protected from the progression of infection to chronic state [37] Since it is the chronic state of HCV infection ... increase in HCV antigen specific leucocytes proliferation indicated that our candidate epitope E2 (p38) vaccine was able to induce cellular immune response, which was critical in viral clearance These...

Ngày tải lên: 12/08/2014, 04:21

10 265 0
Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx

Báo cáo y học: " Kinetics of hepatitis C virus RNA load during pegylated interferon alpha-2a and ribavirin treatment in naïve genotype 1 patients" potx

... the course of treatment could be used for reinforcing the importance of compliance in ensuring a successful outcome Conversely, negative predictive capability would allow clinicians to discontinue ... R, Sacchi P, Ciappina V, Zochetti C, Patruno S, Maiocchi L, Filice G: Viral dynamics and pharmacokinetics of peginterferon alpha-2a and peginterferon alpha-2b in naive patients with chronic hepatitis ... ROC curve method was used to determine the best cut-off that corresponds to the higher rate of sensitivity and specificity of predictions at week 2, week 4, week 8, and week 12 The accuracy of...

Ngày tải lên: 13/08/2014, 13:20

5 322 0
Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

Báo cáo y học: " Distribution of hepatitis C virus genotypes in patients infected by different sources and its correlation with clinical and virological parameters: a preliminary study" pptx

... genotypes and sources of infection in patients with chronic hepatitis C J Infect Dis 1995, 171:1607-1610 Dal Molin G, Ansaldi F, Biagi C, D'agaro P, Comar M, Croce L, Tiribelli C, Campello C: Changing ... interventions and allocate resources, accordingly The aim of our study was to understand the main routes of transmission of HCV in our population, chosen from a referral clinic in Tehran, the capital of ... B core anti- http://www.comparative-hepatology.com/content/5/1/4 body), splenomegaly, ascitis, edema, cirrhosis, grade and stage of liver biopsy, and child score and status (inactive, chronic,...

Ngày tải lên: 13/08/2014, 13:20

6 337 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

... [Internet] CDC: US Viral Hepatitis C http://www.cdc.gov/ncidod/diseases /hepatitis/ c/ plan/Prev_Co ntrol.htm 84 Backmund M, Reimer J, Meyer K, Gerlach JT, Zachoval R Hepatitis C virus infection and injection ... for Hepatitis C virus all need to be elucidated Conflict of interest The authors have declared that no conflict of interest exists References WHO Global surveillance and control of hepatitis C ... Med Sci 2006, 45 Japanese Red Cross Non-A Non-B Hepatitis Research Group Effect of screening for hepatitis C virus antibody and hepatitis B core antibody on incidence of post-transfusion hepatitis...

Ngày tải lên: 02/11/2012, 09:56

6 486 0
Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "The Natural History of Hepatitis C Virus (HCV) Infection"

... development of complications, among different racial and ethnic groups with HCV infection For unclear reasons, African Americans appear to have a higher rate of chronic HCV infection than Caucasians and ... cirrhosis and/ or hepatocellular carcinoma.[3] 50 Summary The chronic nature of hepatitis C infection influences the clinical approach and management of this disease Prevention of the HCV infection ... United States Centers for Disease Control; HBV: hepatitis B virus; HCV: hepatitis C virus; HCC: hepatocellular carcinoma; HIV: human immunodeficiency virus; NASH: non-alcoholic steatohepatitis;...

Ngày tải lên: 02/11/2012, 09:56

6 531 0
Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"

Báo cáo y học: "Molecular Virology of Hepatitis C Virus (HCV): 2006 Update"

... Kolykhalov AA and Rice CM Efficient initiation of HCV RNA replication in cell culture Science 2000; 290: 1972-4 Bartosch B, Dubuisson J and Cosset FL Infectious hepatitis C virus pseudo-particles containing ... as basic and clinical aspects of gastrointestinal malignancies, especially hepatocellular and colorectal carcinoma Darius Moradpour, MD, was Assistant Professor of Medicine and Staff Physician ... J Med Sci 2006, 30 Figure Life cycle of HCV The steps of the viral life cycle are depicted schematically The topology of HCV structural and nonstructural proteins at the endoplasmic reticulum...

Ngày tải lên: 02/11/2012, 10:00

6 497 1
Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

Báo cáo y học: "Epidemiology and Prevention of Hepatitis B Virus Infection"

... preC /C region of genotype C in China [34] Accumulated data suggest the importance of genotype, subgroup and recombination that may influence the biological characteristics of virus and clinical ... adolescent vaccinatin programmes in Italy Vaccine 2000;18:S31-S34 77 Chang MH, Chen CJ,cLai MS Universal hepatitis B vaccination in Taiwan and the incidence of hepatocellular carcinoma in children ... Communicable Diseases Surveillance and Response (CSR) Table Characteristics of endemic patterns of hepatitis B virus infection Source: adapted from Ref.[7] Characteristic Low (%) Chronic infection...

Ngày tải lên: 02/11/2012, 11:12

8 643 0
Diagnosis, Management, and Treatment of Hepatitis C: An Update docx

Diagnosis, Management, and Treatment of Hepatitis C: An Update docx

... Saracco G, Cerchier A, Riva C, Musso A, Ricotti E, et al Human immunodeficiency virus infection as risk factor for mother-tochild hepatitis C virus transmission; persistence of anti -hepatitis C virus ... more of the clinical complications of chronic liver disease — ascites, encephalopathy, variceal bleeding, and/ or impaired hepatic synthetic function — is more problematic Their treatment of choice ... Interpretation Acute or chronic HCV depending on the clinical context Resolution of HCV; Acute HCV during period of low-level viremia Early acute HCV infection; chronic HCV in setting of immunosuppressed...

Ngày tải lên: 08/03/2014, 14:20

40 999 0
Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf

Báo cáo khoa học: Recent contributions of in vitro models to our understanding of hepatitis C virus life cycle pdf

... research: binding process and vaccination development Speci c binding of HCV-like particles was obtained for various hepatic and lymphocyte cell lines and also for dendritic cells, independently of ... mechanisms antiviral screening entry process replication mechanisms intracellular host defences antiviral screening cell attachment vaccination morphogenesis entry process HCVcc Entire life cycle ... process replication mechanisms intracellular host defence evasion mechanisms virus production antiviral screening the replication complex and identification of the cellular partners of HCV replication...

Ngày tải lên: 16/03/2014, 05:20

14 532 0
Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

Báo cáo sinh học: " Evolution of naturally occurring 5''''non-coding region variants of Hepatitis C virus in human populations of the South American region" doc

... TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCAAGATCGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT 283 B Background1 Background2 Background3...

Ngày tải lên: 18/06/2014, 18:20

12 354 0
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

... The HCV IRES nt 1-515 segment was amplified by PCR from pHCV7 7c using forward (5'-gcgcgcggatccgccagccccctgatgggggcgacac-3') and reverse (5'-gcgcgcggatccaggttgcgaccgctcggaagtcttcc-3') oligonucleotides, ... pre-mmu-miR-328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega) The Rluc:miR-328 binding site reporter constructs, in which Rluc is coupled ... (5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3') binding sites into the PmeI site of psiCHECK (Promega) The integrity of the constructs was verified by restriction analysis and DNA sequencing...

Ngày tải lên: 11/08/2014, 07:21

13 362 0
Báo cáo y học: " Characterization of thiobarbituric acid derivatives as inhibitors of hepatitis C virus NS5B polymerase" pot

Báo cáo y học: " Characterization of thiobarbituric acid derivatives as inhibitors of hepatitis C virus NS5B polymerase" pot

... Basic Science Research Program through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science and Technology (2009-0070937), 2010 GRRC fund, and HUFS research ... research fund of 2010 Authors’ contributions J-HL investigated the mechanism of action of the compound SL and MYP contributed in the screening stage of the compound HM conceived of the Lee et ... Bisbocci M, Incitti I, Orsatti L, Harper S, Stansfield I, Rowley M, De Francesco R, Migliaccio G: Mechanism of action and antiviral activity of benzimidazole-based allosteric inhibitors of the hepatitis...

Ngày tải lên: 11/08/2014, 21:21

4 304 0
w