severity of seizures as a forensic risk and case reports
A contrastive analysis of encouraging as a speech act in english and vietnamese
... between semantics and pragmatics and covers some of the basic techniques and key concepts involved in studying and analyzing pragmatic meaning narrowest interpretation of pragmatics Đ Olshtain, E ... communication in a foreign language and partly in Communicative encouraging in English and Vietnamese as a speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of The ... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication...
- 13
- 1,583
- 8
Tài liệu A Matter of Security The Application of Attachment Theory to Forensic Psychiatry and Psychotherapy pptx
... ‘transitional space’ While mentalization as a concept has arguably been part of psychoanalytic thinking since its inception, and as a major line of theorization in France at least for the last forty years ... trainees and members of a Christian congregation Finally, Franziska Lamott, Natalie Sammet and Friedemann Pf äfflin report comparative attachment data from samples of women who have killed and ... literature The terms ‘attachment status’, ‘attachment quality’, and ‘ attachment classification’ (as a result of a classification process) are not really helpful, or rather useless, as they not add...
- 281
- 569
- 0
![Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot](https://media.store123doc.com/images/document/14/rc/at/small_ata1395562826.jpg)
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot
... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... aerobically and anaerobically prepared apoFNR Aerobically or anaerobically prepared apoFNR were incubated with GnHCl + iodoacetate and digested with trypsin, and after separation on Sephadex Peptide...
- 10
- 477
- 0
Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN
... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan ... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... Luxembourg Macau Macedonia, Former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mexico Micronesia, Federated States of Moldova,...
- 28
- 764
- 2
Báo cáo khoa học: Mammalian transglutaminases Identification of substrates as a key to physiological function and physiopathological relevance pot
... b-sandwich, a core (which contains a transamidation site and a Ca2+-binding site, and has a helices and b sheets in equal amounts), and two C-terminal b-barrel domains It has been suggested that glutamyl ... extrusion of TG4 from the coagulating gland [129] FXIII Coagulation FXIII is a plasma TG, and circulates in blood as a heterotetramer consisting of two catalytic A (XIIIA) and two noncatalytic B ... nucleotide-binding activity of tissue transglutaminase and its regulation of transamidation activity Proc Natl Acad Sci USA 99, 2743–2747 Ahvazi B, Boeshans KM, Idler W, Naxa U, Steinert PM & Rastinejad F...
- 17
- 440
- 0
báo cáo hóa học:" Quality of Life as reported by children and parents: a comparison between students and child psychiatric outpatients" ppt
... to several life domains [32] This concept is partly comprised of positive and negative affect as an emotional appraisal of health and life circumstances, as well as an emotional state that is determined ... EXTRA funds and supported by the Norwegian National Council of Mental Health Thanks to all parents and patients participating in the study, and to all personal at the Department of Child and Adolescent ... parametric test Correlations were calculated by Pearson r and Spearman’s rho An alpha level of p < 0.05 indicated statistical significance Results Preliminary analysis The Spearman’s correlations...
- 9
- 494
- 0
Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx
... Lee et al Fig Photomicrographs of a section of the case with stage II mammary gland adenoma ( 1a, 1b, 1c) and of a section of the case with stage V malignant mixed tumor ( 2a, 2b, 2c) stained with ... prognostic value of several parameters All statistical analyses were performed with software package SPSS (Release 8.0, SPSS inc.) and a P-value of
- 7
- 325
- 0
Báo cáo y học: " Paraneoplastic limbic encephalitis as a cause of new onset of seizures in a patient with non-small cell lung carcinoma: a case report" potx
... neurological syndromes, have been described as 'well characterized' paraneoplastic antibodies [2] PEM is characterized pathologically by neuronal loss and inflammatory infiltrates in particular areas of ... secretion and rare paraneoplastic neurological syndromes [1] The most common paraneoplastic neurological syndromes are Lambert-Eaton myasthenic syndrome and paraneoplastic encephalomyelitis (PEM) Paraneoplastic ... tumor Because LE is associated relatively often with cancer, it is characterized as a 'classical' paraneoplastic neurological syndrome [2] Clinical diagnosis of PLE associated with lung cancer is...
- 5
- 259
- 0
Identification and functional validation of caldesmon as a potential gastric cancer metastasis associated protein
... Distant metastasis Presence of distant metastasis cannot be assessed No distant metastasis Distant metastasis Table 1.1 TNM staging classification of gastric cancer 11 1.2.2 Metastasis Is a Multi-Step ... the TMA study 65 Table 3.3 Increased fascin staining index was correlated with serosal invasion and lymph node metastasis, and increased caldesmon pericellular staining index was associated ... metastasis Activation of oncogenic signaling pathways is an important feature for cancer progression and metastasis Amplification of tyrosine kinase MET has been observed in certain gastric cancer...
- 142
- 254
- 0
Identification of plant as a novel and alternative host model for burkholderia pseudomallei
... GAATTCCTCGAACCGTCCATCGTC 60.0 KHWTTSS2P2 GGATCCGATCGTGTCGAACGAGATCA 60.0 KHWTTSS2P3 GGATCCGGCATCGACGGTATTCT 66.9 KHWTTSS2P4 AAGCTTATATCGCCGGGATAGCGTA 66.9 BTTTSS2P1 aaGAATTCGGTGGCCTCCAGAAACAGT ... gorillas (Sprague and Neubauer, 2004) Cases in animals have been reported in several countries including Australia, China, Thailand, Iran, Saudi Arabia, South Africa, Brazil and France One of the most ... 20% of all community acquired septicaemias and 40% of sepsis related mortality in northeast Thailand (White, 2003) It is classified as a risk group agent as well as a potential bioterrorism agent...
- 119
- 420
- 0
Identification and characterization of IFI30 as a glioblastoma specific promoter for glioma gene therapy
... astrocytoma grades I, II [astrocytoma], III [anaplastic astrocytoma] and IV [glioblastoma or GM]), oligodendrogliomas, ependymomas and mixed gliomas Gliomas constitute 77% of the primary malignant brain ... and nearly all low-grade tumours eventually progress to high-grade malignancy (Schwartzbaum et al., 2006) Glioblastoma multiforme, anaplastic astrocytoma and higher grade oligodendrogliomas are ... was changed and GCV was added at concentrations 10-100μM and incubated at 37°C, 5% CO2 24 hours after GCV addition the cell viability was measured by the MTS assay Assays were performed by adding...
- 92
- 404
- 0
Tài liệu The Man of Letters as a Man of Business docx
... that in writing of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with ... much of a business man after all He must still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft!...
- 21
- 544
- 0
Tài liệu Test of English as a Foreign Language doc
... 110 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... Sch of Intl Service AMIDEAST Catholic U of America Embassy of Botswana Embassy of the Arab Republic of Egypt Embassy of India Embassy of Japan Embassy of Kuwait Embassy of Malaysia Embassy of ... Lithuania Luxembourg Macau Macedonia, former Yugoslav Republic of Madagascar Madeira Islands Malawi Malaysia Maldives Mali Malta Northern Mariana Islands Marshall Islands Martinique Mauritania Mauritius...
- 36
- 869
- 0
Tài liệu History Of Egypt, Chaldæa, Syria, Babylonia, And Assyria In The Light Of Recent Discovery pdf
... was given by the work of M de Morgan, who excavated sites of the early dynastic as well as of the predynastic age Among these was a great mastaba-tomb at Nakõda, which proved to be that of a ... of the deceased have been added Sakkõra was used as a place of burial in the latest as well as in the earliest time The Egyptians of the XXVIth Dynasty, wearied of the long decadence and devastating ... them In like manner, through the Semitic Babylonians, the Assyrians, the Kassites, and the inhabitants of Palestine and Syria, and of some parts of Asia Minor, Armenia, and Kurdistan, all in turn...
- 147
- 739
- 0
Báo cáo khoa học: Subcellular compartmentalization of FADD as a new level of regulation in death receptor signaling pdf
... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... and cytoplasmic (lanes 3–8) fractions were prepared from total cellular lysates and were immunoblotted using antibody against FADD Effective separation of nuclear and cytoplasmic fractions was...
- 10
- 483
- 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx
... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... )346/)214 Total chromatin (lanes and 10), and no DNA (lanes and 6) were used as positive and negative PCR controls As a marker (lane M), the 100-bp gene ruler (Fermentas) was used isoforms Furthermore,...
- 8
- 426
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008