... between semantics and pragmatics and covers some of the basic techniques and key concepts involved in studying and analyzing pragmatic meaning narrowest interpretation of pragmatics Đ Olshtain, E ... communication in a foreign language and partly in Communicative encouraging in English and Vietnamese asa speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of The ... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication...
... ‘transitional space’ While mentalization asa concept has arguably been part of psychoanalytic thinking since its inception, andasa major line of theorization in France at least for the last forty years ... trainees and members ofa Christian congregation Finally, Franziska Lamott, Natalie Sammet and Friedemann Pf äfflin report comparative attachment data from samples of women who have killed and ... literature The terms ‘attachment status’, ‘attachment quality’, and ‘ attachment classification’ (as a result ofa classification process) are not really helpful, or rather useless, as they not add...
... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, anda minor signal of threefold alkylated FNR ... aerobically and anaerobically prepared apoFNR Aerobically or anaerobically prepared apoFNR were incubated with GnHCl + iodoacetate and digested with trypsin, and after separation on Sephadex Peptide...
... BWA BRA BRN BGR BFA BDI KHM CMR CAN CPV CYM CAF TCD CHL CHN Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan ... NATIVE LANGUAGE CODES AFR AKA ALB AMA ARA ARM ASM AZE BAM BAK BAQ BEL BEM BEN BER BIK BOS BUL BUR CAT CEB NYA CHI CHV Afrikaans Akan Albanian Amharic Arabic Armenian Assamese Azerbaijani Bambara ... Luxembourg Macau Macedonia, Former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mexico Micronesia, Federated States of Moldova,...
... b-sandwich, a core (which contains a transamidation site anda Ca2+-binding site, and has a helices and b sheets in equal amounts), and two C-terminal b-barrel domains It has been suggested that glutamyl ... extrusion of TG4 from the coagulating gland [129] FXIII Coagulation FXIII is a plasma TG, and circulates in blood asa heterotetramer consisting of two catalytic A (XIIIA) and two noncatalytic B ... nucleotide-binding activity of tissue transglutaminase and its regulation of transamidation activity Proc Natl Acad Sci USA 99, 2743–2747 Ahvazi B, Boeshans KM, Idler W, Naxa U, Steinert PM & Rastinejad F...
... to several life domains [32] This concept is partly comprised of positive and negative affect as an emotional appraisal of health and life circumstances, as well as an emotional state that is determined ... EXTRA funds and supported by the Norwegian National Council of Mental Health Thanks to all parents and patients participating in the study, and to all personal at the Department of Child and Adolescent ... parametric test Correlations were calculated by Pearson r and Spearman’s rho An alpha level of p < 0.05 indicated statistical significance Results Preliminary analysis The Spearman’s correlations...
... Lee et al Fig Photomicrographs ofa section of the case with stage II mammary gland adenoma ( 1a, 1b, 1c) andofa section of the case with stage V malignant mixed tumor ( 2a, 2b, 2c) stained with ... prognostic value of several parameters All statistical analyses were performed with software package SPSS (Release 8.0, SPSS inc.) anda P-value of
... neurological syndromes, have been described as 'well characterized' paraneoplastic antibodies [2] PEM is characterized pathologically by neuronal loss and inflammatory infiltrates in particular areas of ... secretion and rare paraneoplastic neurological syndromes [1] The most common paraneoplastic neurological syndromes are Lambert-Eaton myasthenic syndrome and paraneoplastic encephalomyelitis (PEM) Paraneoplastic ... tumor Because LE is associated relatively often with cancer, it is characterized asa 'classical' paraneoplastic neurological syndrome [2] Clinical diagnosis of PLE associated with lung cancer is...
... Distant metastasis Presence of distant metastasis cannot be assessed No distant metastasis Distant metastasis Table 1.1 TNM staging classification of gastric cancer 11 1.2.2 Metastasis Is a Multi-Step ... the TMA study 65 Table 3.3 Increased fascin staining index was correlated with serosal invasion and lymph node metastasis, and increased caldesmon pericellular staining index was associated ... metastasis Activation of oncogenic signaling pathways is an important feature for cancer progression and metastasis Amplification of tyrosine kinase MET has been observed in certain gastric cancer...
... GAATTCCTCGAACCGTCCATCGTC 60.0 KHWTTSS2P2 GGATCCGATCGTGTCGAACGAGATCA 60.0 KHWTTSS2P3 GGATCCGGCATCGACGGTATTCT 66.9 KHWTTSS2P4 AAGCTTATATCGCCGGGATAGCGTA 66.9 BTTTSS2P1 aaGAATTCGGTGGCCTCCAGAAACAGT ... gorillas (Sprague and Neubauer, 2004) Cases in animals have been reported in several countries including Australia, China, Thailand, Iran, Saudi Arabia, South Africa, Brazil and France One of the most ... 20% of all community acquired septicaemias and 40% of sepsis related mortality in northeast Thailand (White, 2003) It is classified asarisk group agent as well asa potential bioterrorism agent...
... astrocytoma grades I, II [astrocytoma], III [anaplastic astrocytoma] and IV [glioblastoma or GM]), oligodendrogliomas, ependymomas and mixed gliomas Gliomas constitute 77% of the primary malignant brain ... and nearly all low-grade tumours eventually progress to high-grade malignancy (Schwartzbaum et al., 2006) Glioblastoma multiforme, anaplastic astrocytoma and higher grade oligodendrogliomas are ... was changed and GCV was added at concentrations 10-100μM and incubated at 37°C, 5% CO2 24 hours after GCV addition the cell viability was measured by the MTS assay Assays were performed by adding...
... that in writing of the Man of Letters asa Man of The Man of Letters asa Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as ... knows that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with ... much ofa business man after all He must still have a low rank among practical people; and he will be regarded by the great mass of Americans as perhaps a little off, a little funny, a little soft!...
... 110 Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Azores Bahamas Bahrain Bangladesh Barbados Belarus ... Sch of Intl Service AMIDEAST Catholic U of America Embassy of Botswana Embassy of the Arab Republic of Egypt Embassy of India Embassy of Japan Embassy of Kuwait Embassy of Malaysia Embassy of ... Lithuania Luxembourg Macau Macedonia, former Yugoslav Republic of Madagascar Madeira Islands Malawi Malaysia Maldives Mali Malta Northern Mariana Islands Marshall Islands Martinique Mauritania Mauritius...
... was given by the work of M de Morgan, who excavated sites of the early dynastic as well asof the predynastic age Among these was a great mastaba-tomb at Nakõda, which proved to be that ofa ... of the deceased have been added Sakkõra was used asa place of burial in the latest as well as in the earliest time The Egyptians of the XXVIth Dynasty, wearied of the long decadence and devastating ... them In like manner, through the Semitic Babylonians, the Assyrians, the Kassites, and the inhabitants of Palestine and Syria, andof some parts of Asia Minor, Armenia, and Kurdistan, all in turn...
... nuclear FADD and its nuclear–cytoplasmic translocation? Functional DISC assembly and activation of caspase-8 is generally considered to be a ‘point of no return’ in the apoptotic signaling cascade ... between the nucleus and the cytoplasm Whereas cytoplasmic TRADD mediates apoptosis through FADD and caspase-8 activation, nuclear TRADD acts through a mitochondrial apoptosis pathway [28] Our study ... and cytoplasmic (lanes 3–8) fractions were prepared from total cellular lysates and were immunoblotted using antibody against FADD Effective separation of nuclear and cytoplasmic fractions was...
... 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3¢; Site-2 mut, 5¢-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3¢; ... gene and lg of control luciferase plasmid DNA (pGL3, Promega) were used for transfection CAT and luciferase activities were measured as described [17] DNase I protection assay Rat liver and HeLa ... )346/)214 Total chromatin (lanes and 10), and no DNA (lanes and 6) were used as positive and negative PCR controls Asa marker (lane M), the 100-bp gene ruler (Fermentas) was used isoforms Furthermore,...