set instantiation scn at apply site

... Mechanical complications and reconstruction strategies The exact rate of mechanical complications following hip spacer implantation remains unknown Despite numerous reports about these complications, only ... on the operated extremity, the patient should be rather considered as a candidate for a resection arthroplasty and not for a spacer implantation For prevention of any spacer dislocation due to ... data available that have demonstrated that the insertion of a metallic endoskeleton significantly improves the mechanical properties of hip spacers or reduces the rate of mechanical complications...

Ngày tải lên: 26/10/2012, 09:53

... GAGGAGGACCACCATGCATCT TTGTGCAAGCAGTCCAGAAAGA GGATGCAGGCAATACTCCTG CCATACTGCCAAGAAAAGATGAT ACAGAGGCATACAAGTGCAGATG TGTTTAGGCTTGATCTCCAGCTT CTGGGATTCCTGACCATTGGT GTTGGCTCTCTGTTTCAATGCA GGGCAGGTGTTTTTGTGTTGA ... qACT.fw1 qACT.rv1 T7 T3 GTGCGGATCTSTTCTTCACAC CACCGTCACAGATATGTACCATATAGTC GGTGGTCTTTTGCAGAGTCATTT TTCTTTAGATACTGCTGAAGCCA AGGTCTGCATCAACCCCAAG GCATCAACCCCAAGACCAAATGG CGGGACGGTGTTGAGAGTGGA GAGAGTGGACCGGCACCAACA ... GGGCAGGTGTTTTTGTGTTGA AAGAGCGACTTGCGGGTATG CCGTGGGTGACATCGTTACA TCAGGACATTGAACCTCACTGTCT CAACAGGGAAAAGATGACACAGATC GGGACAGCACAGCCTGGAT TAATACGACTCACTATAGGG CGCAATTAACCCTCACTAAAG Vector Ó FEBS 2004...

Ngày tải lên: 16/03/2014, 18:20

... This mechanism should include identification of these lesions as a strand break, verification of the nature of the 3¢ end, and identification of a satisfactory pathway for repair The XRCC1 component ... substrate to a greater extent than to the control substrate (Fig 2A), indicating damage specificity of cross-linking When 5¢labelled gap-containing oligonucleotide attached to the beads was incubated ... indicated antibodies (B) Alternatively, a 5¢-labelled gap-containing substrate was used After incubation with cell extract, the beads were washed, the DNA was stripped from the beads by heating at...

Ngày tải lên: 23/03/2014, 11:20

... we can be sure that the results obtained are not due to chance and that they correspond to real features present in the signals Surrogate data are time series that are generated in order to keep ... real noisy data the cyclic relative phase, ϕn,m (t)mod 2π, is preferentially used Note that according to the above equation, the phase difference has to be calculated from the univariate phase angle ... (no amplitude correlation between X and Y) and (X and Y are totally correlated in amplitude) The application of these methods on EEG signals has indicated that phase correlation decreases during...

Ngày tải lên: 21/06/2014, 16:20

... possibilities of the natural regeneration of Douglas fir, – the study of Douglas fir transpiration by direct measurements of transpiration flow, – analysis of the accumulation and chemical composition ... Douglas fir at mesotrophic sites of uplands (the 2nd or the 3rd forest vegetation zone) In assessing production capacities of introduced species it is necessary to mention at the first place data on ... production at the original habitat Data on their production potential, i.e maximum height, diameter and volume, are of great importance For example, Fowells (1965) mentioned a tree that reached...

Ngày tải lên: 07/08/2014, 03:22

... sites, there are no soil information for their site of origin Supporting evidence that the interaction in black pine provenances may be linked to the site soil conditions in relation to the site ... possibly correlate the performance differences to original site characteristics, facilitating wider applications MATERIALS AND METHODS The trial was established in 1986 on three sites Two in Anthrakia ... doing much better in the schist site (Nigrita) It originates from a site of light soil derived from phylosilicate material on metamorphic rocks [7] The small number of sites (only two in the analysis)...

Ngày tải lên: 08/08/2014, 14:21

... digitata, Cordyla pinnata, Pterocarpus erinaceus et S setigera 2.2 Effet de la proximité de S setigera et de l’exposition sur les cultures 2.3 Effet de l’émondage et de la distance au tronc de S setigera ... significatives (figure 6d) 3.2 Effet de l’émondage et la distance au tronc de S setigera sur les cultures L’interaction entre l’émondage et la distance au tronc de S setigera est significative ... fonction de l’orientation par rapport au tronc de S setigera b 600 O ue st 400 200 Nor d Sud Orientation Figure 7a Biomasse en épis de mil (P = 0,0001) en fonction de la proximité de S setigera et de...

Ngày tải lên: 08/08/2014, 14:21

... rarity and points out that more data should be collected to develop our knowledge about diagnosis, histopathological and clinical features, prognosis, and conventional treatment of this neoplasm ... gastroenterostomy site are accompanied by perforation Immunohistochemical stains showed that neoplastic cells were positive for neuron-specific enolase (NSE), synaptophysin and E-cadherin and negative for ... Following respiratory distress secondary to pulmonary metastasis, his health situation got worse and subsequently died in the fourth postoperative month In additionally, the patient was questioned...

Ngày tải lên: 09/08/2014, 03:23

... response (sometimes dramatic) to new target treatments [3,10-12] Clinical studies have shown that the elective medical treatment for patients with inoperable lesions is imatinib (400 mg/die) with ... partecipated in its design and drafting FT participated in the design of the study and collect the clinical data LR participated in the design of the study and collect the clinical data GP participated ... the clinical data AZ participated in the design of the study and collect the clinical data FZ participated in the design of the study and collect the clinical data GCP participated in the design...

Ngày tải lên: 09/08/2014, 07:22

... information about the site, its power infrastructure, installed equipment and antenna information The general information included: • Site information CASE STUDY • Ground elevation • Site location ... STUDY • Coax information ADC Network and Inventory Audit Service ensures accurate and detailed reports and recommendations that affect operational areas including: • Asset verification and recovery ... identify the cell sites was to categorize each site into one of three groups: • Ready for new equipment • Minor modifications needed • Major modification needed For each of the sites, ADC conducted...

Ngày tải lên: 24/01/2014, 12:20

... sentence Example: T: I like to eat oranges Ss: I like to eat oranges T: Apples Ss: I like to eat apples 42 T: Hate Ss: I hate to eat apples T: Marry Ss: Marry hates to eat apples d As mentioned above, ... have a satisfactory communicative competence if not any of his knowledge of probability of occurrence of grammatical forms and communicative functions is developed 3.5 Communicative strategies ... important component of communicative competence II Nature of language skills and oral communication Nature of language skills It has known that language communication involves some skills which...

Ngày tải lên: 29/01/2014, 10:33

... teachers of English at Ke Sat High School to investigate their perceptions of reading difficulties - questionnaire for the 10th form students at Ke Sat High School to collect information about their ... Choose appropriate strategies - Read without considering how to approach the material - Focus attention - Are easily distracted - Anticipate predict - Read to get done - Use fix-up strategies when ... comprehension by : knowing Do not know what to when lack comprehension is - Do not see any organization Add on rather than integrate new + knowing what is information understood - Do not realize they...

Ngày tải lên: 29/01/2014, 14:43

... plot Compound Tat(1–9) Tat(1–9)a Trp1-Tat(1–9) Gly3-Tat(1–9) Ile3-Tat(1–9) Lys2-Tat(1–9) Trp2-Tat(1–9) Trp2-Tat(1–9)* Met-Trp1-G-CSF(1–8) Met-IL-2(1–12) Met-Trp-Val Trp2,Ile3-Tat(1–9) TXA2-R(1–9) ... of Tat(1–9) with this model of DP IV including the substrate Ala-Pro-pNA bound to the active site with Ala at the S1 and Pro at the S2 binding sites In the presence of the docked substrate at ... noncompetitive binding site of substrate-loaded DP IV, docking studies of Tat(1–9) and Trp2-Tat(1–9) with DP IV in the presence of the substrate Ala-Pro-pNA, located at the active site, were carried...

Ngày tải lên: 20/02/2014, 11:20

... reaction mixture with E1 was incubated for exactly 10 at the relevant temperature and the catalytic activity at that temperature was then determined The inactivation temperatures for all the E1 mutants ... concentration 400 lM) after the assay mix had been incubated for 10 at 30 °C Reductive acetylation assay This measures the reductive acetylation of the free lipoyl domain with [2-14C]pyruvate at 25 ... concentrations of pyruvate from 0.2 lM to 4000 lM and the ThDP concentrations from 0.04 lM to 200 lM When determining the kinetic parameters for ThDP, the pyruvate concentration was kept at mM Data...

Ngày tải lên: 20/02/2014, 23:20

... combustible materials from individual batches of materials These small fires are repeatedly set on the sites of previous fires, leading to an accumulation of ash and partially burned materials Insulating ... these three samples These data suggest that similar materials had been burned at these different sites However, one sample from a burning site within the disposal area at the Agbogbloshie Market ... identified at trace levels using a selective SIM method; ( - ) not detected Greenpeace International 11 Box 2: Phthalates Phthalates (or, more accurately, phthalate diesters) are nonhalogenated chemicals...

Ngày tải lên: 05/03/2014, 21:20

... and MgATP as the variable substrates (A) At mM MgATP, positive cooperativity with respect to Glc was observed (nH = 1.95 ± 0.10) (B) At a low (0.05 mM) concentration of MgATP, the cooperativity ... related to partial catalytic activation following (Mg)ATP binding at physiological concentrations of Glc Similar or possibly larger effects of ATP in promoting a catalytically competent state ... valuable conformational probe (unpublished data) Here, it was demonstrated (Fig 3C) that the ligand-free WT hGK (at 25 °C) is partly stabilized by its association with ATP and Glc (Glc > ATP) A B Effect...

Ngày tải lên: 06/03/2014, 00:20

... sodium phosphate, pH 6.0, at 24°C) Benzyl alcohol Wild-type Km kcat kcat ⁄ Km Y78A Km kcat kcat ⁄ Km Y92F Km kcat kcat ⁄ Km L315A Km kcat kcat ⁄ Km F501A Km kcat kcat ⁄ Km F501Y Km kcat kcat ⁄ Km ... H546R GGTCGGTCAATTGCGGCTCCTCGCGGCCGTATG GGTCTAGCTCTGTTCACGCCATGGTCATGATGCG GGTCTAGCTCTGTTCACTTCATGGTCATGATGCG CCGACCATTTGGCCCTTCCTGCTGCC CGCCAACACGATTGCCCACCCAGTTGGAACGG GCCAACACGATTTTACGACCAGTTGGAACGGC ... around the putative substrate-binding site suggested that several residues are potentially involved in substrate oxidation by AAO (Fig 2C) B Evaluation of AAO active site variants Fig AAO catalytic...

Ngày tải lên: 07/03/2014, 11:20

... proximal transcript terminating at mt-TERM [15,16], while the discontinuous outer arrow indicates the promoter distal transcript terminating at D-TERM sites (B) Schematic representation of the mouse ... 22-bp nucleotide sequence (16 274-5¢-ATTACGCAATAAAC ATTAACAA-3¢-16 295) containing the mouse mt H strand transcription start site and also the putative termination site will be referred to as promoter ... transcripts terminating at the Ssp1 site with no significant termination at the D-TERM site (lanes and 3) Addition of 0.5 M KCl fraction (4 lgÆreaction)1), however, yielded a major termination downstream...

Ngày tải lên: 08/03/2014, 08:20

... reaction progress curve to a single exponential rate equation gave an estimate of 0.1 h)1 for the automethylation rate constant, indicating that auto-methylation is a slow process in contrast to the ... incorporated radioactivity remained, indicating that the modification is stable and irreversible under in vitro conditions Auto-methylation occurs at the catalytic cysteine Taking into account the catalytic ... auto-methylation reaction is irreversible, dependent on AdoMet and occurs at the catalytic cysteine residue (A) An automethylation reaction was incubated for h to allow for creation of auto-methylated...

Ngày tải lên: 14/03/2014, 23:20

... into particulates, which can settle into the immediate surroundings 35 Battery Recycling.” Battery Council International “ Available at: http://www.batterycouncil.org/LeadAcidBatteries/BatteryRecycling/tabid/71/Default.aspx ... populations at polluted sites can be exposed through dermal contact with contaminated soil and water, ingestion of contaminated water, inhalation of dust and vapor and ingestion of contaminated ... data from extensive site assessments that can be used for estimating broad impacts These estimates are extrapolations based on estimated at risk populations, limited health information and assumptions...

Ngày tải lên: 15/03/2014, 16:20