serum creactive protein and risk of lung cancer a casecontrol study

Lung cancer - The diagnosis and treatment of lung cancer pdf

Lung cancer - The diagnosis and treatment of lung cancer pdf

... cause of cancer death for men, who account for 60% of lung cancer cases. In women, lung cancer is the second most common cause of cancer death after breast cancer. Survival rates for lung cancer ... research is needed into the symptoms and signs associated with early- and late-stage lung cancer and the factors associated with delay in presentation. For patients diagnosed with lung cancer, ... those of the USA. Lung cancers are classified into two main categories: small-cell lung cancers (SCLC), which account for about 20% of cases, and non-small-cell lung cancers (NSCLC), which account...

Ngày tải lên: 15/03/2014, 00:20

41 479 2
Factors infl uencing the risk of breast cancer – established and emerging ppt

Factors infl uencing the risk of breast cancer – established and emerging ppt

... breast cancer, and as effect modifiers of the association of fat intake and risk of breast cancer. Cancer Causes Control, 8, pp49-56. 18 Collaborative Group on Hormonal Factors in Breast Cancer ... Collaborative Group on Hormonal Factors in Breast Cancer (1996). Breast cancer and hormonal contraceptives: collaborative reanalysis of individual data on 53 297 women with breast cancer and ... http://www.cancerhelp.org.uk/help/default.asp?page=3285 36 Collaborative Group on Hormonal Factors in Breast Cancer (200 2a) . Alcohol, tobacco and breast cancer - collaborative reanalysis of individual data from 53 epidemiological...

Ngày tải lên: 15/03/2014, 01:20

19 516 0
The Diesel Exhaust in Miners Study: A Nested Case–Control Study of Lung Cancer and Diesel Exhaust pptx

The Diesel Exhaust in Miners Study: A Nested Case–Control Study of Lung Cancer and Diesel Exhaust pptx

... Diesel Exhaust in Miners Study: A Nested Case–Control Study of Lung Cancer and Diesel Exhaust Debra T. Silverman, Claudine M. Samanic, Jay H. Lubin, Aaron E. Blair, Patricia A. Stewart, Roel ... considerably larger (US miners: 198 lung cancer deaths out of a total of 278 041 person-years; German miners: 61 lung cancer deaths out of 152 557 person-years), and the US miners had a longer latent ... curves has been reported in studies of other occupational exposures and cancer risk (19). Possible biological explanations for a plateauing effect include saturation of metabolic activation and...

Ngày tải lên: 22/03/2014, 17:20

14 328 0
Báo cáo khoa học: Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells potx

Báo cáo khoa học: Altered expression of tumor protein D52 regulates apoptosis and migration of prostate cancer cells potx

... prostate, breast and ovarian cancer, as demonstrated by DNA microarray analysis and high density tissue microarrays. Its over- expression due to gene amplification was confirmed by array comparative ... prostate cancer [9,10] as well as ovarian cancer [11] due to gene amplifica- tion. The identification of TPD52 as a tumor associ- ated antigen in breast cancer patients highlights its role as a gene amplification ... Journal compilation ê 2008 FEBS 5705 ligands activates FAK, which interacts and activates PI3 kinase. The PI3 kinase activates PKB ⁄ Akt by phosphorylation and activated PKB phosphorylates several...

Ngày tải lên: 30/03/2014, 02:20

11 444 0
Báo cáo y học: "Maternal use of Loratadine during pregnancy and risk of hypospadias in offspring"

Báo cáo y học: "Maternal use of Loratadine during pregnancy and risk of hypospadias in offspring"

... exposure to loratadine was not associated with major malformations. However, the infrequent maternal use of loratadine and the prevalence of hypospadias have a major impact on sample size requirements ... drugs, maternal epilepsy, maternal diabetes and preeclampsia. **Adjusted for smoking, maternal age, birth order, ovulation-inducing drugs, maternal epilepsy, maternal diabetes and preeclampsia. ... are available from January 1, 1996 (Aarhus County) and January 1, 1998 (Ringkoebing and Viborg counties). Drugs sold over the counter are not available in these Prescriptions databases Among...

Ngày tải lên: 02/11/2012, 10:09

5 528 0
Tài liệu Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR pptx

Tài liệu Comparison of lung cancer cell lines representing four histopathological subtypes with gene expression profiling using quantitative real-time PCR pptx

... SLCO 4A1 22-32 TCCATCTGGCTCCTGCTGAAGAAC GCTTCTGAGGCACTCAGGCTGAAC 19 STMN1 21-25 AAAGAACTGGAGAAGCGTGCCTCAG CTGAATTTCCTCCAGGGAAAGATCC 20 TGM2 21-36 CTGGTCACTAACCAACAAGGTTG GAGCAGGAGATAAAGTCAAAGCTG Ct: ... TGTGCATGGGTGAAGGGAGAGC 15 RAB25 21-33 TGATCGGCGAATCAGGTGTGG CAACATCACAGTGCGGGTGGAG 16 S10 0A2 22-27 GCAGCCTGGATGAGAACAGTGACC CAGCCCTGGAAGAAGTCATTGCAC 17 S100P 18-32 GTCTGAATCTAGCACCATGACG GGAAGCCTGGTAGCTCCTTC 18 ... CTGCTTCTCAGTGGCAACAAAC CCGTAGCATGCAGATGTCAAGG 6 FOSL1 18-22 TAAGGCGCGAGCGGAACAAG TCGCTGCAGCCCAGATTTCTC 7 FOXG1 23-36 GCGCCAGCAGCACTTTGAGTTAC TGGTTGTTGCCCAGCGAGTTC 8 GAPDH(GAPD) 21-22 AGTAGAGGCAGGGATGATGTTC...

Ngày tải lên: 15/02/2014, 04:20

12 521 0
Báo cáo khoa học: Epidermal growth factor receptor-regulated miR-125a-5p – a metastatic inhibitor of lung cancer potx

Báo cáo khoa học: Epidermal growth factor receptor-regulated miR-125a-5p – a metastatic inhibitor of lung cancer potx

... Dickinson). Human lung cancer samples Primary human lung cancers and paired noncancerous nor- mal lung samples were obtained from 15 patients treated at the Zhejiang Province Cancer Hospital, with ... identification and characterization of potential factors that regulate EGFR pathways are critical to our understanding of lung cancer development and progression. Emerging evidence has revealed the ... against ERK1 ⁄ 2 and phospho-ERK1 ⁄ 2 were from Chem- icon International, Inc. (CA, USA). Antibody against Akt was from BioVision, Inc. (CA, USA), and antibody against phospho-Akt was from Santa...

Ngày tải lên: 07/03/2014, 00:20

8 537 0
Guidelines for the early detection and screening of breast cancer ppt

Guidelines for the early detection and screening of breast cancer ppt

... health care facilities and accessibility. ã It is important to have accurate and updated census data, as well as data on cancer in general and breast cancer in particular, including age-specific ... results cannot be directly linked Natural history, etiology and risk factors 15 BRCA 1 and BRCA 2 group, and p53, account for the majority of hereditary breast cancers. Ataxia telangiectasia (ATM ... the early detection and screening of breast cancer It is important to have accurate and updated census data on cancer- specific mortality and incidence. There are no significant data to indicate...

Ngày tải lên: 28/03/2014, 23:20

57 490 0
Reducing the Risk of Breast Cancer With Medicine: A Guide for Women potx

Reducing the Risk of Breast Cancer With Medicine: A Guide for Women potx

... Learning About Breast Cancer Breast cancer is a malignant (muh-LIG-nent) tumor that starts with cells in the breast. Malignant means that the cells are cancerous and may spread to other ... breast cancer. A woman’s risk of breast cancer depends on her age and other risk factors. Most women who get breast cancer have no risk factors other than growing older. And many women who have risk ... case. Maybe the medicines reduce the kinds of breast cancers that are easiest to treat. Breast Cancer Risk Factors Age Getting older raises the risk of breast cancer. Family history Having a...

Ngày tải lên: 29/03/2014, 01:20

16 400 0
Updates in the Understanding and Management of Thyroid Cancer Edited by Thomas J. Fahey doc

Updates in the Understanding and Management of Thyroid Cancer Edited by Thomas J. Fahey doc

... breast cancer case, 1 prostate cancer case, 1 case of sigmoid colon cancer, 1 case of liver cancer, 1 case of glioblastoma multiform, 1 case of pancreatic cancer , 1 case of multiple myeloma) ... Helix pomatia agglutinin (HPA) which detects GalNAc1-4 Gal, is a part of a panel of markers for histological characterization of gastric cancer specimens. HPA as well as Ulex europaeus agglutinin ... levels was increased in 28 of 40 papillary carcinomas and in 6 of 7 anaplastic carcinomas compared with normal or hyperplastic thyroid. Immunohistochemical analysis of normal thyroid and papillary...

Ngày tải lên: 30/03/2014, 22:20

314 575 0
Báo cáo hóa học: " Ezrin promotes invasion and metastasis of pancreatic cancer cells" ppt

Báo cáo hóa học: " Ezrin promotes invasion and metastasis of pancreatic cancer cells" ppt

... K, Matsuoka Y, Takasuka N, Takeshita F, Naito A, Iigo M, Alexander DB, Moore MA, Saito I, Ochiya T, Tsuda H: Ductal origin of pancreatic adenocarcinomas induced by conditional activation of a human ... 2010 References 1. Sato N, Funayama N, Nagafuchi A, Yonemura S, Tsukita S, Tsukita S: A gene family consisting of ezrin, radixin and moesin. Its specific localization at actin filament/plasma membrane association ... metastasis of pancreatic cancer cells Yunxiao Meng, Zhaohui Lu, Shuangni Yu, Qiang Zhang, Yihui Ma, Jie Chen * Abstract Background: Pancreatic cancer has a high mortality rate because it is usually...

Ngày tải lên: 18/06/2014, 16:20

14 525 0
w