sepp a unique member of the selenoprotein family

... that the SEA domain functions by orienting the active site cleft of DESC1 toward plasma and ⁄ or extracellular spaces and away from the cell surface and ⁄ or the extracellular matrix The SEA ... structure of the catalytic domain of DESC1 Scheme Domain organization of human DESC1 membrane region The extracellular part of DESC1 consists of a 120-amino acid SEA domain followed by the C-terminal ... to calculate the Rfree The final R and Rfree values of the model are 0.21 and 0.22 for the complete data ˚ set up to 1.6 A The electron density of the whole main chain of the catalytic domain...

Ngày tải lên: 19/02/2014, 00:20

... octanoate; C10, decanoate, C12, dodecanoate, C16, palmitate, BA, benzoate The data are means ± SD of triplicate assays transcripts for the SA and MACS1 genes are present only in the RE area of the ... H., Ioka, R.X., Kamataki, A. , Magoori, K., Takahashi, S., Sakai, J & Yamamoto, T.T (2001) Molecular identification and characterization of two mediumchain acyl-CoA synthetase, MACS1 and the Sa gene ... Yoshihara, Y., Kawasaki, M., Tamada, A. , Fujita, H., Hayashi, H., Kagamiyama, H & Mori, K (1997) OCAM: a new member of the neural cell adhesion molecule family related to zone-to-zone projection of...

Ngày tải lên: 08/03/2014, 02:20

... with the recombinant allergen after affinity purification using the mAb IG12 [18] The natural allergen Phl p was also found to be capable of degrading a synthetic substrate at a papaincleavage site ... are one of the earliest lineages of eukaryotic cells, and the Giardia protease is the earliest known branch of the cathepsin B family [23] Its phylogeny confirms that the cathepsin B lineage evolved ... supernatant containing rPhl p N showed strong degradation of the full-length allergen and accumulation of a truncated  15-kDa fragment at about pH 4.5 (Fig 3A) This sharp band lacked the N-terminal...

Ngày tải lên: 08/03/2014, 22:20

... Tanigawa, Y (1995) Molecular cloning and characterization of a cDNA encoding monoclonal nonspecific suppressor factor Proc Natl Acad Sci USA 92, 3463–3467 10 Nakamura, M., Xavier, R.M & Tanigawa, ... of the 33.5 kDa Ubi-L adduct The 33.5 kDa Ubi-L adduct was digested by V8 protease and subjected to MALDI-MS analysis The data in the second column are the mass values obtained experimentally, ... between the C terminal of the glycine residue of Ubi-L and the lysine of Bcl-G The 33.5 kDa Ubi-L adduct was digested by V8 protease and subjected to MALDI-MS analysis The data in the first column are...

Ngày tải lên: 17/03/2014, 10:20

... mortality of patients with rheumatoid arthritis J Rheumatol 2000, 27:2283-2284 30 Kamihira S, Yamada Y, Hirakata Y, Tomonaga M, Sugahara K, Hayashi T, Dateki N, Harasawa H, Nakayama K: Aberrant expression ... MR, Haemel AK, Wood GS: Apoptosis and melanoma: molecular mechanisms J Pathol 2003, 199:275-288 Hasunuma T, Kayagaki N, Asahara H, Motokawa S, Kobata T, Yagita H, Aono H, Sumida T, Okumura K, ... inhibitor of apoptosis, neutralizing several caspases at the final steps of the apoptosis casR355 Arthritis Research & Therapy Vol No Bokarewa et al Figure (a) aSur2 P < 0.05 aSur1 Oligofectamine...

Ngày tải lên: 09/08/2014, 06:22

... phosphorylation states of Sch9p, as already demonstrated [21] Next, we investigated whether Bud32p is a substrate of Sch9p The HA-tagged Sch9p was immunoprecipitated by the use of the anti-HA affinity ... affinity matrix: Fig 7Ba confirms the immunoprecipitation of Sch9p (lane 1); as controls, the anti-HA matrix was incubated either with a cellular lysate of the untagged strain, or with no lysate (lanes ... for the endogenous kinase in the association with Grx4p, whereas a similar amount of the S25 8A mutant (lane 3) failed to bind Grx4p, as shown by a signal comparable to the background level (lane...

Ngày tải lên: 07/03/2014, 04:20

... ERp57 and the tip of the calreticulin P-domain Proc Natl Acad Sci USA 99, 1954–1959 Satoh M, Shimada A, Keino H, Kashiwai A, Nagai N, Saga S & Hosokawa M (2005) Functional characterization of thioredoxin ... orientation of the bb¢ domains and significant differences in orientation of their a and a domains The catalytic cysteines (orange) of the °C yeast PDI structure face each other (B) The b and b¢ ... cloverleaf A long C-terminal tail folds back and makes contacts with the a and b¢ domains [10] This capping function of the C-terminal tail may have assisted the successful crystallization and structure...

Ngày tải lên: 15/03/2014, 23:20

... Mutagenesis kit (Stratagene, La Jolla, CA, USA) with forward primer 5¢-GAAACGATGC ATTTGTCCTATGCCGACCGTGCGTC-3¢ and reverse primer 5¢-GACGCACGGTCGGCATAGGACAAATGCA TCGTTTC-3¢ The sequence of the ... significance of the lid-loop in GGT catalysis During the preparation of this article, the crystal structures of Bacillus anthracis CapD, a GGT-related enzyme, in the absence and presence of a glutamate ... into the extracellular environment [1]; in mammalian cells, it is bound to the external surface of the plasma membrane [1,5]; and in plants, it is localized to the apoplast and the vacuole [6] The...

Ngày tải lên: 22/03/2014, 21:20

... used as a template with the following primers : R450AUp (5¢-GACGAGTACACGGT GGCCGGATACAACCTCAGGA-3¢) and R450ALo (5¢-TC CTGAGGTTGTATCCGGCCACCGTGTACTCGTC-3¢); Y452AUp (5¢-ACACGGTGCGCGGAGCCAACCTCAAG ... between the two proteins, arguing against a major conformational change of the loop Structural data are available in the Protein Data Bank under the accession numbers 2QDZ (FhaCWT) and 3NJT (FhaCR45 0A) ... the b-barrel in both FhaCWT and the FhaCR45 0A variant Thus, our data strongly argue that the R45 0A substitution has no significant effect on the structure of the FhaC barrel and the POTRA domains,...

Ngày tải lên: 23/03/2014, 03:20

... United States Census classification and reflect parent report based on the following choices: White, Black, Native Hawaiian or Other Pacific Islander, Asian, American Indian or Alaskan native, Other ... populations of children with special health care needs and cancer [17,18] Therefore it is unclear whether the Family Impact Module is a valid and reliable measure for assessing the impact of SCD ... items in the emotional, social, and school functioning scales The physical health summary score is comprised of the average of items in the physical functioning scale and is the same score as the...

Ngày tải lên: 18/06/2014, 18:20

... Manitoba Central Animal Care breeding facility All procedures followed Canadian Council on Animal Care guidelines and were approved by the Animal Care Committee at the University of Manitoba Animals ... hypoxia for 36 h, with sense primer 5¢-GAGAATTC TCG CAG AGC GGG GAG GAG AAC-3¢ and antisense primer 5¢-AT GGATCC TCA AAA GGT ACT AGT GGA AGT TG-3¢ The PCR product was ligated to pGEM-T (Promega) ... Quantification of the western blot bands revealed a nine-fold increase of BNIP3 in KA-injected striatum There was a 3.5-fold increase in CL striatum of the injected animal as compared with striatum...

Ngày tải lên: 22/03/2014, 17:20

... processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa A search in the PROSITE database of protein families and domains [12] with MCA2590 revealed two ... located on the surface of the bacterium and is noncovalently attached to the outer membrane The extracellular localization is in accordance with the prediction of a signal peptide in a primary ... RT-PCR analyses revealed that this regulation takes place at the transcriptional level The concomitant regulation of SACCP and MopE is also in accordance with the possibility that the MCA2590 and...

Ngày tải lên: 23/03/2014, 11:20

... (abolition of the signal) Response element SmFTZ-F1 SF-1 TCA AGGTCA ACA AGGTCA CCA AGGTCA GCA AGGTCA TGA AGGTCA TTA AGGTCA TAA AGGTCA TCT AGGTCA TCG AGGTCA TCC AGGTCA TCA GGGTCA TCA AGGTCC TCA ... was able to transactivate transcription of a reporter gene from the SFRE at a similar level to SF-1 in CV-1 cells This indicates that at least some of the mammalian coactivators are capable of ... lines MATERIALS AND METHODS Parasites A Puerto-Rican strain of S mansoni was maintained in Biomphalaria glabrata snails and golden hamsters (Mesocricetus auratus) Cercariae were released from infected...

Ngày tải lên: 23/03/2014, 21:20

... the genomic DNA from the S cerevisiae S288C strain using the oligonucleotides 5¢GGCGAGCTCAAAATGCTTTACCCAGAAAAATT TGAGG-3¢ and 5¢GGCTCTAGACTATTTATGGAA TTTCTTATC-3¢ that introduced SacI and XbaI ... although the kcat and Km values with ADHVII are approximately half the values found for ADHVI The catalytic efficiencies towards the oxidation of cinnamyl alcohol and several aliphatic alcohols are ... activity Cinnamaldehyde Phenylacetaldehyde Benzaldehyde Coniferaldehyde Veratraldehyde Anisaldehyde Vanillin Propanal Butanal Pentanal Hexanal Heptanal Octanal 2-Methylpropanal 2-Methylbutanal 3-Methylbutanal...

Ngày tải lên: 31/03/2014, 08:20

... (LG0118: 5'-ATGGCAACCCTGTCCCTGAG-3' and LG0117 5'-GGAAACCCAACCACGCTGTA-3') and Page of (page number not for citation purposes) Virology Journal 2009, 6:86 (LG0119: 5'-GCTAACTCTAATGCTGCCACC-3' and LG0136: ... rotaviruses, adenoviruses, and common bacterial and parasitic pathogens was negative [6] Additionally, RTPCR assays for caliciviruses and astroviruses were also negative [6,33] 100% Page of (page number ... pellet particulate matter and the supernatant was then passed through a 0.45 μm filter Total nucleic acid was isolated from 100 μL primary stool filtrate using QiAmp DNA extraction kit (Qiagen) according...

Ngày tải lên: 12/08/2014, 04:21

... (LG0118: 5'-ATGGCAACCCTGTCCCTGAG-3' and LG0117 5'-GGAAACCCAACCACGCTGTA-3') and Page of (page number not for citation purposes) Virology Journal 2009, 6:86 (LG0119: 5'-GCTAACTCTAATGCTGCCACC-3' and LG0136: ... rotaviruses, adenoviruses, and common bacterial and parasitic pathogens was negative [6] Additionally, RTPCR assays for caliciviruses and astroviruses were also negative [6,33] 100% Page of (page number ... pellet particulate matter and the supernatant was then passed through a 0.45 μm filter Total nucleic acid was isolated from 100 μL primary stool filtrate using QiAmp DNA extraction kit (Qiagen) according...

Ngày tải lên: 12/08/2014, 04:22

... 5¢-GGACATCTCCTTCGGCTT-3¢ 5¢-AGTGACCAGCACAGATAGC-3¢ 5¢-GTGGATCCAGTGTTCGTCAT-3¢ 5¢-CCGTGCCCATCGTGTCTGA-3¢ 5¢-CCAGTAGACAAACCACTTCG-3¢ 5¢-CATACCTGGCTTCAAGATGC-3¢ 5¢-CAGGAATTGCCGATAGGATGC-3¢ 5¢-TACTTGCGTTCAGGGGGAGC-3¢ ... acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 237 acids ⁄ 249 amino amino amino amino amino 266 266 266 266 278 AATAAA ⁄ 13 nucleotides AATAAA ⁄ 13 nucleotides AATAAA ⁄ 10 nucleotides AATAAA ⁄ 13 nucleotides ... lobster Panulirus argus MKTLVFCLLLAGAFA MKTLVFCLLLAGAFA MKTLVFCLLLAGAFA MKTLVFCLLLAGAFA KSLILCVLLAGAFA KSLVLCLLLAGAFA KSLVLCLLLAGAFA MKTLVFCLLLVGALA APSGKPKFRRGLNK APSGKPKFRRGLNK APSGKPKFRRGLNK APSGKPKFRRGLNK...

Ngày tải lên: 23/03/2014, 03:20

... construct HA-Lqh3 using the pET-14b vector as template DNA Primer 1, 5Â- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3Â, was designed to add a sequence encoding Apamin and a linker cleavable by ... specically a broad range of factors involved in mRNA processing [29] By analogy, the ability of Lqh3 and possibly other members of the a- like group to affect a wide range of Nav subtypes may be attributed ... mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal structures of a- toxins and their mutants...

Ngày tải lên: 23/03/2014, 09:20

... [26] that they form a dimer in an antiparallel fashion through a pair of the interactions between the middle domain and the C-terminal domain Similarly, the C-terminal 326 amino acids of barley ... We also thank Mr T Kobayakawa (Nagasaki University, Nagasaki, Japan) for the technical assistance This work was supported by Grants-in-Aid for Scientific Research from the Ministry of Education, ... was used to evaluate the binding activity The binding activity of the C-terminal domain (100%) or its mutated forms toward the middleC-terminal domains was quantified as the b-galactosidase activity...

Ngày tải lên: 23/03/2014, 20:22

... nitrogen-fixing cyanobacterium Anabaena sp strain PCC 7120 DNA Res 8, 205–213 Kaneko, T., Tanaka, A. , Sato, S., Kotani, H., Sazuka, T., Miyajima, N., Sugiura, M & Tabata, S (1995) Sequence analysis of the ... prokaryotic cyanobacteria [6] but not from eukaryotic algae and higher plants [4], suggesting that the red algal PS II is closely related to that of cyanobacteria rather than that of eukaryotic algae ... 382–390 20 Nikaido, I., Asamizu, E., Nakajima, M., Nakamura, Y., Saga, N & Tabata, S (2000) Generation of 10,154 expressed sequence tags from a leafy gametophyte of a marine red alga, Porphyra yezoensis...

Ngày tải lên: 31/03/2014, 07:20