... Albumin (g/L) Haemoglobin (g/L) Leucocytes Platelets (cell/×109) (cell/×109) Total aminoacids (μM/L) AA = amino acids; ALT = alanine aminotransferase AP = alkaline phosphatase; AST = aspartate ... of the abnormal amino acid profile, basically by decreasing phenolic aromaticaminoacids These results may explain at least in part the hopeful effects of albumin dialysis on hepatic encephalopathy ... Circulating levels of total, branched and aromaticaminoacids Results are shown in patients with alcoholic hepatitis (AH) and pruritus (control) Circulating levels of total, branched and aromatic...
... Shimada H: Usefulness of artificial liver support for pretransplant patients with fulminant hepatic failure Transplant Proc 2004, 36:2355-2356 Mita A, Hashikura Y, Tagawa Y, Nakayama J, Kawakubo ... enzyme released in liver injury, as are aspartate aminotransferase and alanine aminotransferase (ALT) It is common to regard monitoring serum LDH as of little value because it is produced in various ... normal range of our assay system, the median of the serum LDH was calculated as 174 U/L in this study Statistical analysis Differences in clinical backgrounds and laboratory data between conservative...
... de-escalation may answer this question Conclusions As part ofa global management of empiric antibiotherapy in an ICU, de-escalation might be safe and feasible in a large proportion of patients and ... the statistical analysis JC, RJ and CA gathered and analyzed the data JM, JC, SM and CA drafted the manuscript All authors read and approved the final manuscript Competing interests The authors ... study was to assess the application ofa de-escalation strategy on empirical antibiotics management We particularly analyzed the clinical impact of this attitude in terms of re-escalation, recurrent...
... Braunstein, A. E (1947) Labilization of a- hydrogen ofaminoacids under the action of aminoferase Biokhimia 12, 556–568 (in Russian) Ó FEBS 2004 Esaki, N., Nakayuma, T., Sawada, S., Tanaka, H & Soda, K ... The anchoring of a- carboxylate and a -amino group in the external aldimine defines automatically the positions of the a- proton and the side chain of any bound amino acid The lability of the a- proton ... the Lys257 amino group and a water molecule providing a favorable mutual orientation of the amino group, the water, and the a- proton of the external aldimine The formation ofa symmetrical six-membered...
... (Mannheim, Germany) Ethanol (> 99%) was obtained from Panreac (Barcelona, Spain) Urea was a product of Acros (Pittsburgh, PA, USA) The QuickchangeTM kit containing Pfu DNA polymerase, 10 · reaction ... Luria–Bertani broth and isopropyl thio-b-d-galactoside were purchased from USB (Cleveland, OH) Salmon testes DNA and some analytical grade chemicals such as EDTA, Tris ⁄ HCl, CaCl2, NaCl and ... conformation of denatured proteins Here we show that a specific single mutation or removal ofa specific fragment can cause large changes in the native state of SNase Fig Steady-state fluorescent spectra of...
... CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG ... Sense Antisense Sense Antisense Sense Antisense Sense Antisense CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG ... LumiGLOTM was from Cell Signaling (Beverly, MA, USA), and AdvantageÒ polymerase mix was from Clontech (Palo Alto, CA, USA) All other reagents were of the best quality and commercially available Expression...
... organic acid stress Auxotrophic requirements for aromaticaminoacids dramatically increase sensitivity to weak organic acid stress, a sensitivity suppressed by amino acid supplementation Platings of ... of these acids (Fig 1; strains with no auxotrophic requirements for aromaticamino acids) It appeared though that acetate and sorbate sensitivities were being enhanced with the loss of both Azr1p ... to catalyse uptake ofaromaticaminoacids from the medium Probably this is due to the weak organic acid exerting a strong inhibition of the activity of the Tat2p amino acid permease, though this...
... biodegradable biomaterials The synthesis of PEUs by AP of TAADs with ACs in DMA solution was carried out by Katsarava and coworkers [52] However, recently Katsarava et al [53] have found that high-molecular-weight ... “self-destructive” at a target rate A comparison of the PEAs and polylactide (PDLLA) in vitro biodegradation data showed that PEAs exhibited a higher tendency toward enzyme-catalyzed biodegradation than PDLLA ... backbones N,N′-adipoyl-bis-l-phenylalanine was separated as one of the main products of biodegradation of PEAs composed of adipic acid, phenylalanine, and 1,4-butanediol (PEA 4F4) [66] 5.2 Amino...
... l-aspartate is catalyzed by aspartase and maleate to fumarate by maleate isomerase: maleate isomerase aspartase Maleate 003Ǟ fumarate 06Ǟ l-asparatate The industrial l-aspartate production by enzymatic ... production of the side products, malate and d-alanine: aspartase aspartate b-decarboxylase Fumarate + NH3 0Ǟ l-asparate 008Ǟ l-alanine + CO2 ȇ ȇ malate d-alanine l-Alanine is produced at a level of 10 ... useful as a chiral starting material in chemical synthesis and as a starting material for medicines, cosmetics, and food additives References Data from Japan Amino Acid Association Aida K, Chibata...
... Takata H, Kuriki T, Okada S, Takesada Y, Iizuka M, Minamiura N & Imanaka T (1992) Action of neopullulanase Neopullulanase catalyzes both hydrolysis and transglycosylation at a- (1 fi 4)- and a- (1 ... stimulates dibasic and neutral amino acid transport and has sequence similarity to glucosidases Proc Natl Acad Sci USA 89, 5596–5600 Chillaron J, Roca R, Valencia A, Zorzano A & Palacin M (2001) ... presence of full GH13 domain B in hcHAT1 and the absence of its parts in hcHAT2 indicate the eventual intermediary or primordial character of both hcHAT1 and hcHAT2 with regard to the appearance of...
... to any other sequences available in FASTA and BLAST database programs at the DNA Data Bank of Japan Recently, we reported the cloning and sequencing of the gene encoding 4 -amino- 3-hydroxybenzoate ... 10 Takenaka, S., Asami, T., Orii, C., Murakami, S & Aoki, K (2002) A novel meta-cleavage dioxygenase that cleaves a carboxylgroup-substituted 2-aminophenol: purification and characterization of ... metacleavage pathway of 2-aminophenol in Pseudomonas sp strain AP-3 (A) Proposed pathway of 4 -amino- 3-hydroxybenzoic acid in Bordetella sp strain 10d (10) I, 4 -amino- 3hydroxybenzoic acid; II, 2 -amino- 5carboxymuconic...
... including those of extradiol dioxygenases available in the FASTA AND BLAST database programs at the DNA Data Bank of Japan The gene encoding 4 -amino- 3-hydroxybenzoate 2,3-dioxygenase is currently ... Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical ... Crystallization and characterization J Biol Chem 243, 2673–2681 Murakami, S., Nakanishi, Y., Kodama, N., Takenaka, S., Shinke, R & Aoki, K (1998) Purification, characterization, and gene analysis of catechol...
... increasing local dielectrostatic constant Table Kinetic parameters of API variants as obtained with Boc-ValLeu-Lys-MCA as substrate monitored at 37 °C Enzyme kcat/Km(lM)1Æs)1 )a pK2 ASA of ˚ His210 ... catalytic triad ACKNOWLEDGEMENT We are grateful to Dr T Yamazaki for NMR measurements, Y Yagi for the amino acid analysis, and Y Yoshimura for the sequence analysis REFERENCES Masaki, T., Nakamura, K., ... as active as native API with VLK-MCA as a substrate (Table 1) This means that Trp169 does not play a role as an electron-rich entity but as a large planar hydrophobic entity that can effectively...
... of this program consist of an initial demonstration of laboratory capability and an ongoing analysis of spiked samples to evaluate and document data quality The laboratory must maintain records ... µg/mL of each internal standard compound The addition of 10 µL of this standard to 5.0 mL of sample or calibration standard would be equivalent to 30 µg/L 7.3.3 Analyze each calibration standard according ... internal standard, and calculate response factors (RF) for each compound using Equation Equation where: As = Area of the characteristic m/z for the parameter to be measured Ais = Area of the characteristic...
... as a safeguard against laboratory contamination 8.1.4 The laboratory must, on an ongoing basis, spike and analyze a minimum of 10% of all samples to monitor and evaluate laboratory data quality ... requirements of this program consist of an initial demonstration of laboratory capability and an ongoing analysis of spiked samples to evaluate and document data quality The laboratory must maintain records ... reference file of material data handling sheets should also be made available to all personnel involved in the chemical analysis Additional references to laboratory safety are available and have been...
... truncated NBD2 construct, NBD2-DC, which lacked the last 42 aminoacids Figure 2A and Table show that the ATPase activity of NBD2-DC was greater than that of SUR2B but similar to that of NBD 2A, favoring ... similar to that of NBD 2A This suggests that the final 42 aminoacidsof SUR2B may reduce its hydrolytic activity, and that the catalytic activity of SUR 2A is not measurably affected by its final ... Experimental repeats (n) refer to separate protein preparations Data points from each preparation were obtained in duplicate Values are given as mean ± standard error of the mean Significance was tested...
... in cardiac fatty acid metabolism and adenine nucleotide metabolism, respectively Induction was mediated via the protein kinase A pathway and partly through that of mammalian target of rapamycin, ... Shiraga T, Miyamoto K, Tanaka H, Yamamoto H, Taketani Y, Morita K, Tamai I, Tsuji A & Takeda E (1999) Cellular and molecular mechanisms of dietary regulation on rat intestinal H+/peptide transporter ... to be regulated by growth factors and nutritional status, particularly amino acid availability [164] Thus, the ADSS1 response to protein kinase A and mammalian target of rapamycin signalling subsequently...