... ^ Ci A B Ci S Co Full Adder FA Ci Co A[3:0] B[3:0] Ci S[3:0] Co + Ci Co 4-bit Adder Truth Table for Full Adder Ci - Carry In S - Sum Co - Carry Out A0 B0 Ci S0 Co Expanded 4-bit Adde r FA Ci Co A1 B1 Ci S1 Co FA A2 B2 Ci S2 Co FA A3 B3 Ci S3 Co FA FIGURE ... useful combina- tional building blocks such as a subtractor, decrementer, adder/subtractor, and 26 Microprocessors CLK D CK R Q 1 0 RESET D N N N Q LD CNT INC Q LD R CK N N INC Y A N N INC D incrementer FIGURE ... and C, while hardware interfacing examples uses C to keep code complexity low and improve clarity. The book’s CD-ROM includes a 120-day demo version of the PICC-18 C compiler for the PIC18F242 from...
Ngày tải lên: 23/03/2014, 00:20
Ngày tải lên: 23/09/2012, 14:47
Text extraction from name cards using neural network
... == ì= cavg c c cavg c c ncnlavg _ 0 _ 0 _ ; (2) == ì= 255 _ 255 _ _ cavgc c cavgc c ncnravg ; (3) ]255,0[),(_ = cnstdstdn c ; (4) ]_,0[),(_ cavgcnstdstdl c = ; (5) ]255,_[),(_ cavgcnstdstdr c ∈= . ... Take cavgF _= as an example, then: )_,_max( )_,_min( ))(),(max( ))(),(min( ),,( 21 21 21 21 21 cc cc cavgcavg cavgcavg CFCF CFCF FCCSIM = = (7) then the relative similarity RSIM for a certain ... found in name card scanners which readily capture name card images followed by optical character recognition (OCR) to build a name card database. The application provides for document information...
Ngày tải lên: 05/11/2012, 14:54
Using LINQ to DataSet
... disparate sources. You can mix LINQ to Objects and LINQ to DataSet content in the same query simply by including each source in the From clause. C# // Build an ad hoc collection, although you could ... a LINQ query. Dwonloaded from: iDATA.ws Chapter 18 Using LINQ to DataSet 313 Chapter 18 Quick Reference To Do This Include a DataTable instance in a LINQ query Call the DataTable object’s ... CurrentStatus = sts.Description Order By OrderID As in LINQ to Objects, the actual processing of a LINQ to DataSet query does not occur until your code references content from a constructed query. However,...
Ngày tải lên: 03/10/2013, 00:20
Using LINQ to Entities
... "A" select cu; Visual Basic Dim result = From cu In context.Customers Where EntityFunctions.Left(cu.FullName, 1) = "A" Select cu Beyond the canonical functions, LINQ to Entities ... CustomerName = cu.FullName }; } Visual Basic Using context As New SalesOrderEntities(connectionString) Dim results = From cu In context.Customers Order By cu.FullName Select CustomerID = cu.ID, CustomerName ... string-conversion functions from SQL Server can be called from LINQ: Ascii, Char, CharIndex, Difference (a Soundex-related function), IsDate, IsNumeric, NChar, PatIndex, QuoteName, Replicate, SoundCode (more...
Ngày tải lên: 03/10/2013, 00:20
Using LINQ to SQL
... Chapter 20 Using LINQ to SQL 335 C# using (SalesOrderLink context = new SalesOrderLink(connectionString)) { var results = from cu in context.Customers orderby cu.FullName select new { CustomerID ... CustomerID = cu.ID, CustomerName = cu.FullName }; } Visual Basic Using context As New SalesOrderLink(connectionString) Dim results = From cu In context.Customers Order By cu.FullName Select CustomerID ... context.Customers Select cu.ID, cu.FullName, context.AgedInvoices(cu.ID, 90) Order By cu.FullName You can also call these functions directly, as long as a valid context exists. C# decimal pending = context.AgedInvoices(whichCustomer,...
Ngày tải lên: 03/10/2013, 00:20
Combating NOx from refinery sources using SCR by Hans Jensen-Holm and Peter Lindenhoff pot
... Catalytic Cracking (FCC) units in which FCC catalyst fines are carried over from the regenerator. L: Wave length t: Wall thickness P c : Channel pitch P p : Plate pitch L t P c P p ... deactivation mechanism 11 4.2 SCR DeNOx in fluid catalytic cracking units (FCCU) 14 4.2.1 SCR design issues 14 4.2.2 ABS condensation considerations 15 4.2.3 Catalyst selection 17 4.2.4 Catalyst cleaning ... The SCR DeNOx process and catalyst 5 3.1 The SCR process 5 3.2 The SCR catalyst 7 4 Refinery SCR applications 10 4.1 SCR for steam cracking and reformer furnaces 10 4.1.1 Chromium deactivation...
Ngày tải lên: 14/03/2014, 10:20
Báo cáo khoa học: Selective detection of superoxide anion radicals generated from macrophages by using a novel fluorescent probe pdf
... 12-myristate 13-acetate were obtained successfully using a confocal laser scanning microscope. Abbreviations DBZTC, 2-chloro-1,3-dibenzothiazolinecyclohexene; ROS, reactive oxygen species; SOD, superoxide ... salt effect that decreases fluorescence intensity. Effect of the fluorescent probe concentration The concentration of DBZTC directly decided whether O 2 ặ was trapped completely, which determined ... molecules, but can also be converted to other more toxic radicals such as HOặ,H 2 O 2 , 1 O 2 , and so on [3]. Under consenescence or special physical conditions, excessive O 2 ặ can lead to coronary...
Ngày tải lên: 16/03/2014, 11:20
Báo cáo khoa học: Investigation of the substrate specificity of a b-glycosidase from Spodoptera frugiperda using site-directed mutagenesis and bioenergetics analysis pdf
... (underlined) and mutated codon (NNN, in bold). Thus, the primer sequence used on mutations at position 3 9 was 5 Â- CGCTACAGCCTCCTACNNNAT CGAAGGTGCTTGG-3Â, w ith AAC and GAG as the mutated codons for Q39N ... (1998) The family 1 b-glucosidases from Pyrococcus furiosus and Agrobacterium f aecalis shar e a common catalytic mechanism. Biochemistry 37 , 17170–17178. 5. Paloma, F., Can ˜ ada, F.J., Barbero-Jime ´ nez, ... substrate is accommodated by the aglycone subsite 2 , which may actually be composed of several subsites (+1, +2, +3, etc.). According to the CAZy database, family 1 currently comprises 427 b-glycosidases,...
Ngày tải lên: 16/03/2014, 18:20
released from the grip of what he carried freedom from his c
... member of the infantry, carries not only hatchet with which he cuts off a thumb of an enemy. Harry Dobbins carried his girlfriend's panties around his neck, and Dave Jansen carried ear plugs.Throughout the ... soldiers carry on tour. O'Brien tells how much certain items weigh and what they are used for It is as if Cross can't help but to think of this woman when he gets bored of the war. Cross ... How she herself had no special feelings for Cross and she was just writing to him because she felt a responsibility to. Although seemingly reaching out to him, she in fact had no deep feeling for...
Ngày tải lên: 21/03/2014, 22:49
PREDICTION OF CHEMICAL REACTIVITY PARAMETERS AND PHYSICAL PROPERTIES OF ORGANIC COMPOUNDS FROM MOLECULAR STRUCTURE USING SPARC pptx
... Fraction Figure 4. Fraction of the major microscopic species of N-phenylglycine as a function of pH The numbers on the top of each curve correspond to the microscopic species. 1, 3, 2N, 2Z corresponds ... R, and ρ ele describes the susceptibility of a particular reaction center to electrostatic effects. Since the reaction center can not discriminate the sources of the electric fields, ρ ele ... “mechanistic” descriptions commonly utilized in structure-activity analysis, such as induction, resonance and field effects. SPARC execution involves the classification of molecular structure...
Ngày tải lên: 22/03/2014, 14:20
Báo cáo khoa học: Llama single-domain antibodies directed against nonconventional epitopes of tumor-associated carcinoembryonic antigen absent from nonspecific cross-reacting antigen doc
... VH1S: 5Â-CATGCCATGACTCGCGGCCCAGCCGGCCATGGC CCAGGTGCAGCTGGTGCAGTCTGG-3Â;5Â VH2S: 5Â-CATGCCATGACTCGCGGCCCA GCCGGCCATGGC CCAGGTCACCTTGAAGGAGTCTGG-3Â;5Â VH3S: 5Â-CATGCCATGACTCGCGGCCCA GCCGGCCATGGC CGAGGTGCAGCTGGTGGAGTCTGG-3Â;5Â ... pJFVH3S (CTTTACTATTCTCAC GGCCA TGGCGGCCGAGGTGCAGCTGGTGG) and 3Â c- myc– 6His ⁄ HindIII (CCGCGCGCGC CAAGACCC AAGCTTG GGCTARTGRTGRTGRTGRTGRTGTGCGGCCCCAT TCAGATC) to add the HindIII site for further cloning, ... GCCGGCCATGGC CGAGGTGCAGCTGGTGGAGTCTGG-3Â;5Â VH4S: 5Â-CATGCCATGACTCGCGGCCCA GCCGGCCATGGC CCAGGTGCAGCTGCAGGAGTCGGG-3Â) and one for- ward primer (CH2FORTA4). These primers allow the ampli- fication of two bands corresponding...
Ngày tải lên: 23/03/2014, 05:22
Báo cáo khoa học: "Identifying Word Translations from Comparable Corpora Using Latent Topic Models" potx
... Linguistics Identifying Word Translations from Comparable Corpora Using Latent Topic Models Ivan Vuli ´ c, Wim De Smet and Marie-Francine Moens Department of Computer Science K.U. Leuven Celestijnenlaan ... approach borrows an idea from information retrieval and constructs word vectors over a shared latent topic space. Values within vectors are the TF-ITF (term frequency - inverse topic frequency) scores ... importance of the source word w i across all source topics. Rare words are given a higher im- portance and thus they tend to be more descriptive for a speci c topic. The inverse topical frequency for...
Ngày tải lên: 23/03/2014, 16:20
Báo cáo khoa học: "Learning to Extract Relations from the Web using Minimal Supervision" ppt
... the Association of Computational Linguistics, pages 576–583, Prague, Czech Republic, June 2007. c 2007 Association for Computational Linguistics Learning to Extract Relations from the Web using ... generic placeholders for the two entity names. The subsequence kernel induces a feature space where each dimension corresponds to a sequence of words. Any such sequence that matches a subsequence ... the corpo- rate acquisition relationship. For each pair, a bag of sentences containing the two arguments can be ex- tracted from a corpus of text documents. The corpus is assumed to be sufficiently...
Ngày tải lên: 23/03/2014, 18:20
removal of basic blue 159 from aqueous solution using
... phenolic compounds. Different processes for color removal typically include physical, chemical and biological schemes. Some processes, such as electrochemical techniques and ion pair extraction, ... the adsorption capacity of some speci c solutes through ionic interactions. Natural sorbents have been obtained from agricultural waste, such as corn cobs, coconut shell, sugar cane bagasse ... the peaks around 3444.64 cm -1 , 2923.34 cm -1 , 1733.88 cm -1 and 1037.36 cm -1 resulted from O-H stretch, C- H stretch, C= O stretch and C- O stretch, respectively. It can be found that banana...
Ngày tải lên: 06/05/2014, 09:02