second fundamental form of a surface

homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group

homomorphisms of the fundamental group of a surface into psu(1,1), and the action of the mapping class group

... thank my friends of many years Avra Charalambous, Georgia Papageorgiou and Anna Sidera for their continual support and the great summers I spent with them I thank my grandparents Panagiota and ... Maria Agrotis, Lisa Berger, Arlo Caine, Derek Habermas, Selin Kalaycioglu, Alex Perlis and Sacha Swenson Also many thanks to the wonderful staff of the Department of Mathematics I give a special ... brothers Michael-Zenios and Charalambos Finally I thank the Department of Mathematics at the University of Arizona 5 DEDICATION To my parents, Andreani and Savvas Konstantinou, who made all this...

Ngày tải lên: 13/11/2014, 09:14

88 324 0
Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

Báo cáo khoa học: Common mode of DNA binding to cold shock domains Crystal structure of hexathymidine bound to the domain-swapped form of a major cold shock protein from Bacillus caldolyticus pot

... proteins have been implicated in transcriptional activation and repression, regulation of alternative splicing, regulation of mRNA stability, translational activation or repression and RNA packaging ... bacteria are very similar and may be attributed to the same function, a finding that has already been demonstrated for the CSP paralogues of B subtilis and E coli [3,41] Apart from eubacteria, ... areas, respectively Structural organization of the ligand B Fig Binding of hexathymidine to amphipathic platforms of a BcCsp swapped dimer (A) Topological representation of a functional unit of...

Ngày tải lên: 23/03/2014, 09:21

15 333 0
Báo cáo y học: " Second site escape of a T20-dependent HIV-1 variant by a single amino acid change in the CD4 binding region of the envelope glycoprotein" doc

Báo cáo y học: " Second site escape of a T20-dependent HIV-1 variant by a single amino acid change in the CD4 binding region of the envelope glycoprotein" doc

... antisense primers (WS1, 5'-ATAAGCTTAGCAGAAGACA-3', and 3'envMD4, 5'-GCAAAATCCTTTCCAAGCCC-3') in a 50 µl PCR reaction DNA products were analysed on a 1% agarose gel that was pre-stained with ethidium ... but we gradually used less culture supernatant per passage Cells and supernatant samples were taken at regular time points and stored at -70°C Proviral DNA isolation, PCR amplification and sequencing ... inhibitor J Antimicrob Chemother 2004, 54:333-340 Menzo S, Castagna A, Monachetti A, Hasson H, Danise A, Carini E, Bagnarelli P, Lazzarin A, Clementi M: Genotype and phenotype patterns of human immunodeficiency...

Ngày tải lên: 13/08/2014, 09:20

11 364 0
Optimal fundamental characteristic of a quantum harmonic

Optimal fundamental characteristic of a quantum harmonic

... cooling load when there exists a bypass heat leakage The optimal performance of the quantum Carnot refrigerator at high temperature limit is derived and analyzed in detail with numerical examples, ... etc Jin et al [22] introduced bypass heat leakage into exergoeconomic performance optimization of a quantum harmonic Carnot engine, and the bypass heat leakage arose from the thermal coupling ... harmonic population n becomes variable in the adiabatic process The effect of non-adiabatic phenomenon on the performance of the quantum refrigerator is similar to that of internally dissipative friction...

Ngày tải lên: 20/11/2015, 14:04

16 124 0
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot

... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... aerobically and anaerobically prepared apoFNR Aerobically or anaerobically prepared apoFNR were incubated with GnHCl + iodoacetate and digested with trypsin, and after separation on Sephadex Peptide...

Ngày tải lên: 23/03/2014, 15:20

10 477 0
Adsorption of halogenated organic molecules and photo induced construction of a covalently bonded second organic layer on silicon surfaces

Adsorption of halogenated organic molecules and photo induced construction of a covalently bonded second organic layer on silicon surfaces

... surface, resulting in the formation of a secondary attachment of 3-chloro-1-propanol layer on the Si surface The secondary attachment of 3-chloro-1-propanol layer was verified by the appearance of ... (secondary ion mass spectroscopy), XPS can provide vital elemental and chemical information, quantitative information, low sample damage and diverse application in surface and materials analysis, ... special functionality of the molecules that are attached on silicon surfaces [2–4] The study of the direct and covalent attachment of organic molecules to Si surfaces has attracted a great deal of...

Ngày tải lên: 14/09/2015, 08:43

207 640 0
A general form of the Second Main Theorem for hypersurfaces

A general form of the Second Main Theorem for hypersurfaces

... are taken in to the account of counting functions) Motivated by the case of hyperplanes, in this paper we generalize Theorem B to the case of arbitrary hypersurfaces, and the multiplicities of ... Vietnam National Foundation for Science and Technology Development (NAFOSTED) The first named author was partially supported by Vietnam Institute for Advanced Study in Mathematics, and by the Abdus ... This completes the proof of Theorem 1.1 References [1] G Dethloff and T V Tan and D D Thai, An extension of the CartanNochka second main theorem for hypersurfaces, Internat J Math 22 (2011), 863-885...

Ngày tải lên: 14/10/2015, 08:23

9 254 0
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university

Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university

... treated equally as other skills in terms of time allocation In fact, it has not drawn much attention of both teachers and learners, they are generally less aware of its importance And teaching and ... comprehension as a process of acquiring the meaning of the message based on the incoming language data from sounds, to words, to grammatical relationships, and ultimately to the meaning Schemata are hierarchically ... knowledge and global understanding to comprehend the meaning of a message As Nauman (2002: 25) sees that top-down process “focus on the overall meaning of a passage and the application of schemata Schemata...

Ngày tải lên: 27/12/2013, 20:26

99 806 0
Tài liệu Báo cáo khoa học: A zymogen form of masquerade-like serine proteinase homologue is cleaved during pro-phenoloxidase activation by Ca2+ in coleopteran and Tenebrio molitor larvae docx

Tài liệu Báo cáo khoa học: A zymogen form of masquerade-like serine proteinase homologue is cleaved during pro-phenoloxidase activation by Ca2+ in coleopteran and Tenebrio molitor larvae docx

... an affinity-purified antibody raised against the purified 45-kDa Tm-mas A secondary antibody (alkaline phosphatase-conjugated anti-rabbit IgG, Bio-Rad) was used at a dilution of : 1000 Phage DNA ... pro-PO activation reaction MATERIALS AND METHODS Animals, collection of hemolymph and hemocytes T molitor larvae (mealworm) were maintained on a laboratory bench in terraria containing wheat bran ... molecular level This paper describes the purification and cDNA cloning of a 45-kDa protein that acts as a pro-PO activating cofactor in T molitor larvae The deduced amino acid sequence of the 45-kDa...

Ngày tải lên: 21/02/2014, 03:20

9 463 0
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

... was not trained on enough data Belz and Reiter (2006) carry out a comparison of automatic evaluation metrics against human domain experts and human non-experts in the domain of weather forecast ... these figures, Cahill et al (2007) show that a log-linear model based on structural features and a language model score performs considerably better realisation ranking than just a language model In ... breakdown of the items A ranking mechanism based on so-called optimality marks can lead to a certain “asymmetry” between parsing and in each part of the experiment.5 generation in the sense that not all...

Ngày tải lên: 22/02/2014, 02:20

9 480 0
Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

Báo cáo khoa học: The propeptide in the precursor form of carboxypeptidase Y ensures cooperative unfolding and the carbohydrate moiety exerts a protective effect against heat and pressure pot

... In contrast, a DSC analysis of the mature form (CPY) revealed an apparently symmetrical single peak but the ratio of DHcal/ DHv was determined to be 1.74 (DHcal and DHv values were 765 and 440 ... or was obtained from Oriental Yeast Co (Lot 21003805) (Osaka, Japan) and proCPY was prepared as the same manner as CPY, with minor modifications Dgly CPY and Dgly proCPY, in which the asparagine ... first transition in the 0.1–150 MPa range, a second from 150 to 450 MPa, and a third at pressures above 500 MPa (Fig 3B) The first transition was small with a half transition, Pm1, of 50 MPa or lower...

Ngày tải lên: 07/03/2014, 21:20

7 439 0
Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

Báo cáo khoa học: Identification and functional expression of a second human b-galactoside a2,6-sialyltransferase, ST6Gal II docx

... glycoprotein a1 -Acid glycoprotein Fetuin Galb1-4GlcNAc-Ra NeuAca2-6Galb1-4GlcNAc-R NeuAca2-3Galb1-3GalNAca1-O-Ser/Thrc NeuAca2-3Galb1-3[Neu5Aca2-6]GalNAca1-O-Ser/Thrc NeuAca2-6(3)Galb1-4GlcNAc-Rc Galb1-3GalNAca1-O-Ser/Thr ... two specific primers For 6I 5¢-CGATGAATTC GTTAACGCTCATCACCATCACCATCACGGGAAA TTGGCCATGGGGT-3¢ containing a HpaI site and Back 6I 5¢-CGATGGTACCGTACTTGTTCATGCTTAGG-3¢ and subcloned into pUC19 for further ... Galb1-3GalNAca1-O-Ser/Thr Galb1-4GlcNAc-R Gala1-O-pNp GalNAca1-O-pNp GlcNAca1-O-pNp Galb1-4GlcNAcb-O-octyl Galb1-3GlcNAcb-O-octyl Galb1-3GalNAca1-O-bn Galb1-4GlcNAc Galb1-3GlcNAc LNnT: Galb1-4GlcNAcb1-3Galb1-4Glc...

Ngày tải lên: 08/03/2014, 08:20

12 584 0
Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf

Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf

... explained by assuming that only a small fraction of the fragment has a conformation that is commensurate with membrane-binding The on-rates for Gla–EGFN and Gla–EGFNC are about a factor of five ... faster than for the Gla-domain presumably due to a further stabilization of the structure of the Gla-domain, indicating that less than 1% of the free isolated Gla-domain has a conformation that ... including a conformational change and a model including a bivalent analyte both gave good fits to the experimental data The results obtained with the bivalent analyte model is shown in Fig In all cases...

Ngày tải lên: 08/03/2014, 23:20

6 402 0
Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx

Gold, Peace, and Prosperity..Gold, Peace, and Prosperity:The Birth of a New Currency Second pptx

... delight of the bureaucrats, politicians, international bankers, multinational corporations, and some labor leaders The age of the managed fiat currency was born The M anaged Fiat Currency Standard As ... standard, the CPI increased 10 percent In his 1848 Communist Manifesto, Karl Marx urged: “Centralization of credit in the hands of the state, by means of a national bank with state capital and ... society and nation, but to adjust and discharge the balance of exchanges between different nations It must be something which has a value abroad, as well as at home, and by which foreign as well as...

Ngày tải lên: 15/03/2014, 09:20

111 1,2K 0
On a Fundamental Reorganisation of the Landesbanks and Savings Banks Sector in Germany ppt

On a Fundamental Reorganisation of the Landesbanks and Savings Banks Sector in Germany ppt

... structures at DekaBank and transfer DekaBank to the sole ownership of the savings banks DekaBank and other banks of the S-Finanzgruppe [savings banks financial group] that are owned by the savings banks ... taken over by means of a complex arrangement by the German Savings Banks Association financial sector and thus also stave off a repeat of the current financial crisis The interconnectedness of ... interconnectedness of savings banks and Landesbanks It is a matter of public record that key segments of the German Landesbanks lack a stable and self-sustaining business model and have neither a sustainable,...

Ngày tải lên: 15/03/2014, 10:20

26 499 0
The Evolving Spatial Form of Cities in a Globalising World Economy pot

The Evolving Spatial Form of Cities in a Globalising World Economy pot

... www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free ... www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free ... www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free download from www.hsrcpublishers.ac.za Free...

Ngày tải lên: 16/03/2014, 11:20

64 394 0
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot

... by MMOH and MMOB when absorbed to an electrode surface, via a reaction that may involve hydrogen peroxide as an important intermediate Conformational changes in MMOH induced by MMOB appear to be ... 552–556 Gallagher, S.C., Callaghan, A. J., Zhao, J., Dalton, H & Trewhella, J (1999) Global conformational changes control the reactivity of methane monooxygenase Biochemistry 38, 6752–6760 Wallar, ... in the absence of reductant (NADH or NADPH) and MMOR As in the natural sMMO reaction [11], substrate oxygenation was facilitated by MMOB but not the truncated form MMOBtru Unlike the natural system,...

Ngày tải lên: 17/03/2014, 09:20

6 464 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... the manufacturer GTATTCAAAAGTGGTCCCGGACAAAATGAGGACTTG TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC CATTTTGTCCGCCAAGACTTTTGAATACTTTCAAGTGC CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG ... CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG CCTCATTTCCTCCGGGAAGACTTTTGAATAC CGGACAAGGTGAGGACTTGGTACTTACTGGATAC CAAGTCCTCACCTTGTCCGGGAAGACTTTTG Proteases Papain (EC 3.4.22.2) was purified, stored as inactive S-(methylthio)papain ... kinetics of association of the cystatin A mutants with papain, cathepsin L and cathepsin B were analyzed Ó FEBS 2002 5654 A Pavlova et al (Eur J Biochem 269) Table Equilibrium and rate constants at...

Ngày tải lên: 17/03/2014, 10:20

10 533 0
w