... found in the nucleus as we show in Figure 1 (61,110) In sharp contrast to other serine/threonine protein kinases such as mitogen-activated protein kinase (MAPK), protein kinase A (PKA), PKB/Akt, and ... reveals that degradation of Pim-1 protein appears to be mediated in part by the ubiquitin- proteasome pathway Cells treated with MG-132, a proteasome inhibitor, display an increase in ubiquitin- ... Kitanaka, C., Noguchi, K., Muramatsu, T., Asai, A. , and Kuchino, Y Physical and functional interactions between Pim-1 kinase and Cdc2 5A phosphatase Implications for the Pim-1-mediated activation
Ngày tải lên: 07/08/2014, 15:20
... financial analyst, accounting career, 64 financial consultant, accounting career, 64 Financial Jobs, industry-specific jobsearch Website, 78 financial planning, finance career, 66, 67 financial ... Ranked and Rated (Bert Sperling and Peter Sander), 28 Index real estate, finance career, 67, 68 real estate broker, finance career, 67 real estate financial analyst, finance career, 67 real estate ... finance career, 66–67 internship opportunity, 37 corporate finance and restructuring associate, finance career, 67 corporate real estate manager, finance career, 67 corporations, accounting career,
Ngày tải lên: 23/05/2018, 13:53
Decreased expression of the β2 integrin on tumor cells is associated with a reduction in liver metastasis of colorectal cancer in mice
... forward 5′-ATGTGGGCCCACACTCACTGC-3′ and reverse 5′-TTAACAAAAGGCAGCACCGT3′; VEGF: forward 5′-TGTACCTCCACCATGCCAAG-3′, reverse 5′-ACTTGATCACTTCATGGGACTTCT-′3′; COX-2: forward 5′-TGCACTATGGTTACAAAAGCT ... conformity with institutional guidelines and national and international laws for experimental animal care The animals were fed a standard chow and had access to water ad libitum All the proceedings ... adhesion and transendothelial migration in breast cancer cell line by up-regulation of LFA-1 (alpha L beta2) and VLA-4 (alpha4beta1) Exp Cell Res 2005;304(1):116–26 Papas MG, Karatzas PS, Papanikolaou
Ngày tải lên: 06/08/2020, 03:31
BACHELOR OF APPLIED SCIENCE with a major in Health Science with an Option in Physician Assistant Studies
... (Physician Assistant Committee, 2002, and AAPA, 2007) Statutory definitions, program approval information, and licensure related to Physician Assistants are explained in 458.347, Florida Statutes (Appendix ... review, with transfer and advising assistance provided MDC will maintain transcripts of BAS-HS, PA Studies students and program graduates in accordance with MDC policies and procedures and will maintain ... Multimedia interactive patient management cases are available to both faculty and students and require annual updating The Human Patient Simulator (HPS), programmed with sophisticated software to
Ngày tải lên: 19/10/2022, 01:32
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of ... was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region is provided in
Ngày tải lên: 06/03/2014, 01:20
MASTERS OF WATERCOLOUR PAINTING WITH INTRODUCTION BY H. M. CUNDALL, I.S.O., F.S.A.EDITED BY GEOFFREY HOLME LONDON: THE STUDIO, LTD., 44 LEICESTER SQUARE, W.C.2 1922-1923.CONTENTSPAGE Introduction by H. M. Cundall, I.S.O., F.S.A. ILLUSTRATIONS IN COL docx
... Thomas, Jun Old Palace Yard, Westminster vi Prout, Samuel Palazzo Contarini Fasan on the Grand Canal, Venice xix Pyne, James Baker View in Italy xxiii vi Rooker, A. R .A. , Michael (Angelo) Village ... user, provide a copy, a means of exporting a copy, or a means of obtaining a copy upon request, of the work in its original "Plain Vanilla ASCII" or other form Any alternate format must include the ... equipment including outdated equipment Many small donations ($1 to $5,000) are particularly important to maintaining tax exempt status with the IRS The Foundation is committed to complying with the laws
Ngày tải lên: 06/03/2014, 13:20
Báo cáo khoa học: The effect of replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding ppt
... replacing the axial methionine ligand with a lysine residue in cytochrome c-550 from Paracoccus versutus assessed by X-ray crystallography and unfolding Jonathan A R Worrall, Anne-Marie M van ... main- and side-chain atoms in the ligand loop containing the K100 are however, observed To accommodate K100 as a ligand a number of main-chain atoms are displaced relative to their positions in ... being minimal the trapping of two main-chain conformations and increased B-factors at 295 K suggests that the presence of the coordinating Lys in some way can in? ??uence the dynamics of the ligand
Ngày tải lên: 07/03/2014, 17:20
Reproductive System Structure, Development and Function in Cephalopods with a New General Scale for Maturity Stages pot
... spermatophoric gland (Laptikhovsky and Nigmatullin, 1987) Juvenile phase and physiological maturation Physiological maturity, functional maturation and maturity Initially the embryonic gonad in ... rigid capsules, capsule glands and albumin glands are present in a complex of pallial glands These differ in their origin and function (Chukchin, 1984) Oviductal glands in octopus secrete an adhesive ... (oviducal, nidarnental and accessory), while in the suborder Oegopsida only oviducal and nidamental glands are found In the subfamily Enoploteuthinae, oviducal glands are well developed but nidamental
Ngày tải lên: 14/03/2014, 16:20
Estimating Inflation Expectations with a Limited Number of Inflation-Indexed Bonds ∗ doc
... Australian Financial Markets Association 2008). 6 In? ??ation swaps are now more liquid than in? ??ation-indexed bonds and may provide alternative data for use in estimating in? ??ation expectations at ... in? ??ation expectations in Australia are well anchored within the Reserve Bank of Australia’s in? ??ation target range of 2 to 3 percent, and that in? ??ation expectations are less volatile than in? ??ation ... that in? ??ation risk premia decreased in the United Kingdom, first after the Bank of England adopted an in? ??ation target and then again after it was granted inde- pendence. Using U.S. Treasury In? ??ation-Protected
Ngày tải lên: 15/03/2014, 07:20
WITH BRITISH GUNS IN ITALY A TRIBUTE TO ITALIAN ACHIEVEMENT pdf
... have fought in turn against Frenchmen and Germans, against Russians and Austrians, against Bulgarians, Turks and Chinamen, against Boers, and even against Americans, but never, except for a ... comradeship in arms in Austria and Italy, in France and in the Balkans. During the nineteenth century Italy in her Wars of Liberation gained, in a degree which this generation can hardly realise, ... WAR ON THE ISONZO FRONT CHAPTER V PALMANOVA CHAPTER VI AQUILEIA AND GRADO CHAPTER VII A GRAMOPHONE AND A CHAPLAIN ON THE CARSO CHAPTER VIII A FRONT LINE RECONNAISSANCE CHAPTER IX AN EVENING
Ngày tải lên: 15/03/2014, 12:20
Báo cáo khoa học: The chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain doc
... chloroplast ClpP complex in Chlamydomonas reinhardtii contains an unusual high molecular mass subunit with a large apical domain Wojciech Majeran1, Giulia Friso2, Klaas Jan van Wijk2 and Olivier Vallon1 ... genes are also found in Cyanobacteria [22] and in the genome of the Cyanophora cyanelle, an ancestral chloroplast In the green alga Chlamydomonas reinhardtii and in vascular plants, the plastid ... Guillardia theta (Gt, a Cryptophyte) and Thalassiosira pseudonana (Tp, a Diatom) The Viridiplantae (green, of a lighter shade for chloroplast genes) are Arabidopsis thaliana (At), Chlamydomonas
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: A pathway through interferon-c is the main pathway for induction of nitric oxide upon stimulation with bacterial lipopolysaccharide in mouse peritoneal cells pot
... designated NF-jBd (5¢-CAT GGG GAC TCT CCC TTT GGG AAC AGT TAT GCA AAA TAG CTC TGC AGA GCC TGG AGG GGT CGA-3¢) [12] and the IRF-1 consensus sequence oligo- nucleotide (5¢-GGA AGC GAA AAT GAA ATT GAC ... each cytokine was measured using a specific sandwich ELISA, according to the manufacturer’s instructions (Endogen) using matched antibody pairs. A 96-well EIA/RIA plate (Corning Inc.), coated with a coating ... lymphocytes, as determined by morphological criteria. The murine macrophage cell line RAW264.7, originally from the American Type Culture Collection (Manassas, VA, USA) and maintained in our laboratory, was
Ngày tải lên: 17/03/2014, 10:20
A course in fluid mechanics with vector field theory d prieve
... should have been normal to the plane containing both vectors during the rotation In the figure above showing a and b, a? ?b is a vector pointing into the page, while b? ?a points out of the page Copyright ... generally any nth rank tensor (in E3) can be expressed as a linear combination of the 3n unit nads For example, if n=2, 3n=9 and an n-ad is a dyad Thus a general second-rank tensor can be decomposed as ... geometrical picture that I can draw which will explain what a dyadic product is It's best to think of the dyadic product as a purely mathematical abstraction having some very useful properties: Dyadic
Ngày tải lên: 17/03/2014, 13:48
RESEARCH DISCUSSION PAPER: Estimating Infl ation Expectations with a Limited Number of Infl ation-indexed Bonds doc
... value In an in? ??ation-indexed bond, the coupons are indexed to in? ??ation so that the real value of the coupons and principal is preserved In Australia, in? ??ation-indexed bonds are indexed with a lag ... expressed in this paper are those of the authors and are not necessarily those of the Reserve Bank of Australia Author: finlayr at domain rba.gov.au Media Office: rbainfo@rba.gov.au Abstract We estimate ... References AFMA (Australian Financial Markets Association) (2008), ‘2008 Australian Financial Markets Report’ Beechey M (2008), ‘Lowering the Anchor: How the Bank of England’s In? ??ation-Targeting Policies
Ngày tải lên: 22/03/2014, 20:20
Báo cáo khoa học: Identification of a domain in the a-subunit of the oxaloacetate decarboxylase Na+ pump that accomplishes complex formation with the c-subunit pot
... part and the biotin-binding domain in the C-terminal part [5]. The b-subunit is an integral membrane protein with nine membrane-spanning a- helices and a fragment inserting into the membrane but ... cholerae. The binding domain on a was identified as a stretch of 40 amino acids (480–520) that is flanked at its N terminus by the carboxyltransferase domain and at its C terminus by the biotin-binding ... sides with proline- and alanine-rich linker peptides. These linker peptides may allow hinge movements of the association domain against the carb- oxyltransferase and the biotin domain. The dynamics of
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Characterization of a-synuclein aggregation and synergistic toxicity with protein tau in yeast potx
... Aggregation of a- synuclein in yeast cells Thioflavin-S staining and lactacystin-mediated proteasome inhibition Thioflavin-S staining (Thio S; Sigma) was performed using a modified method of Kimura and coworkers ... Me2SO-induced aggregation may also reduce the turnover of a- synuclein by preventing its degradation a- Synuclein is eliminated by proteasomal degradation and by rapamycin-induced autophagy The finding that ... 1400 P Zabrocki et al 57 Matsuzaki M, Hasegawa T, Takeda A, Kikuchi A, Furukawa K, Kato Y & Itoyama Y (2004) Histochemical features of stress-induced aggregates in alpha-synuclein overexpressing
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: Crystal structure of the second PDZ domain of SAP97 in complex with a GluR-A C-terminal peptide ppt
... exists for an analogous situation for non-PDZ protein inter- action domains in PSD-95: an intramolecular interac- tion between a ‘hook’ domain and guanylate kinase domain keeps the molecule in a closed ... class I PDZ domain-ligand pairs, additional interactions engaging the amino acid residues at P )1 and P )3 of the peptide in multiple polar and non- polar contacts with the PDZ domain impart increased affinity ... GluR- A are visible, and align as an antiparallel b-strand in the binding groove of SAP97 PDZ2 . The free carboxylate group and the aliphatic side chain of the C-terminal leucine (Leu907), and
Ngày tải lên: 30/03/2014, 10:20
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
... Glutamine incorporation in Caco-2 proteins determining the relative uptake of glutamine; (b) by searching for changes in the intestinal proteome; and (c) by examining glutamine incorporation into ... basolaterally administered glutamine led to a time-dependent increase of label in the cells with a maximum at 24 h, after which a steady state level was reached Remarkably, an increase of radioactivity ... cytoplasmic proteins that can bind to the membrane surface in response to elevations in intracellular calcium [45] Annexin A2 is an F-actin binding protein and participates in the formation of...
Ngày tải lên: 20/02/2014, 01:20
Đề tài " The distribution of integers with a divisor in a given interval " ppt
... The author also thanks G´rald Tenenbaum for several preprints of his work and for informe ing the author about the theorem of Rogers mentioned above, and thanks INTEGERS WITH A DIVISOR IN AN INTERVAL ... This can be interpreted as the assertion that the conditional probability that a random integer has exactly divisor in (y, 2y] given that it has at least one divisor in (y, 2y], tends to zero as ... conversations about the paper Much of this paper was written while the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy of Sciences Finally, the author...
Ngày tải lên: 06/03/2014, 08:21
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
... Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC ... TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC ... 5¢-GTTGCTGTTAAACTGAACCGCCGAT-3¢ (Trp551 fi Ala), 5¢-GTTGCTGTTAGCCTGAACCCAC GAT-3¢ (Phe554 fi Ala), 5¢-GTTGCTTGCAAACTGAA CCCACGAT-3¢ (Asn555 fi Ala) and 5¢-GTTGCTGTTA GCCTGAACCGCCGAT (Trp551 fi Ala ⁄ Phe554 fi Ala)...
Ngày tải lên: 16/03/2014, 12:20