searching yahoo with a bookmarklet in netscape
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
Ngày tải lên :
20/02/2014, 01:20
... Glutamine incorporation in Caco-2 proteins determining the relative uptake of glutamine; (b) by searching for changes in the intestinal proteome; and (c) by examining glutamine incorporation into ... basolaterally administered glutamine led to a time-dependent increase of label in the cells with a maximum at 24 h, after which a steady state level was reached Remarkably, an increase of radioactivity ... cytoplasmic proteins that can bind to the membrane surface in response to elevations in intracellular calcium [45] Annexin A2 is an F-actin binding protein and participates in the formation of...
- 15
- 506
- 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt
Ngày tải lên :
06/03/2014, 08:21
... The author also thanks G´rald Tenenbaum for several preprints of his work and for informe ing the author about the theorem of Rogers mentioned above, and thanks INTEGERS WITH A DIVISOR IN AN INTERVAL ... This can be interpreted as the assertion that the conditional probability that a random integer has exactly divisor in (y, 2y] given that it has at least one divisor in (y, 2y], tends to zero as ... conversations about the paper Much of this paper was written while the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy of Sciences Finally, the author...
- 68
- 409
- 0
Báo cáo khoa học: Concerted mutation of Phe residues belonging to the b-dystroglycan ectodomain strongly inhibits the interaction with a-dystroglycan in vitro pot
Ngày tải lên :
16/03/2014, 12:20
... Ala reverse GTTAGTAGGTGAGAAATCGGCGGTTCAGTTTAACAGCAACA TGTTGCTGTTAAACTGAACCGCGCATTTCTCACCTACTAAC GAGAAATCGTGGGTTCAGGCCAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTGGCCTGAACCCACGATTTCTC TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC ... TCGTGGGTTCAGTTTAACAGCAACAGCCAGCTC GAGCTGGCTGTTGCTGTTAAACTGAACCCACGA TCTGCCCCTGGAGCCCTGCCCCA TGGGGCAGGGCTCCAGGGGCAGA CCTCGTCCTGCCGCCTCCAATGCTCTGGA TCCAGAGCATTGGAGGCGGCAGGACGAGG GCTCTGGAGCCTGACGCCAAGGCTCTGAGTATTGC ... 5¢-GTTGCTGTTAAACTGAACCGCCGAT-3¢ (Trp551 fi Ala), 5¢-GTTGCTGTTAGCCTGAACCCAC GAT-3¢ (Phe554 fi Ala), 5¢-GTTGCTTGCAAACTGAA CCCACGAT-3¢ (Asn555 fi Ala) and 5¢-GTTGCTGTTA GCCTGAACCGCCGAT (Trp551 fi Ala ⁄ Phe554 fi Ala)...
- 15
- 337
- 0
what can you do with a major in biology real people, real jobs, real rewards (what can you do with a major in...)
Ngày tải lên :
01/06/2014, 10:54
... English years years years years Social Studies years years years years Math* years years years years Lab Science** years years years years Foreign Language years years years years Academic Electives ... need-based financial aid is in the form of loans that students—and their families—have to pay back later But we make the clear point that getting a college education is well worth the financial ... must apply for them separately Sending in your financial aid application does not mean you’ve applied for a private scholarship, except those that the college itself awards Many organizations award...
- 142
- 375
- 0
Báo cáo hóa học: " Reversal of TMS-induced motor twitch by training is associated with a reduction in excitability of the antagonist muscle" ppt
Ngày tải lên :
19/06/2014, 08:20
... either a ballistic or a ramp pinch task, an increase in force and acceleration, associated with an increase in MEP amplitude, was observed in the muscle involved in the training, but not in a muscle ... acquisition and learning are associated with an increase in target muscle cortical excitability and a modulation of intracortical inhibition, but the relationship of cortical excitability changes with ... Boston, MA, USA 4MIT, Boston, MA, USA 5Institut Guttmann, Universitat Autonoma de Barcelona, Barcelona, Spain 6Laboratory of Neuromodulation, Spaulding Rehabilitation Hospital, Harvard Medical School,...
- 8
- 432
- 0
Báo cáo hóa học: "Research Article Harnack Inequality for the Schrödinger Problem Relative to Strongly Local Riemannian p-Homogeneous Forms with a Potential in the Kato Class" potx
Ngày tải lên :
22/06/2014, 22:20
... Riemannian p-homogeneous forms; we define a suitable notion of Kato class of measures We assume that the potential is a measure in the Kato class and we prove a Harnack inequality (on balls that are ... Matematica “Francesco Brioschi”, Politecnico di Milano, Piazza Leonardo Da Vinci 32, Italy; Accademia Nazionale delle Scienze detta dei XL, Via L Spallanzani 7, Italy Email address: marbir@mate.polimi.it ... was initially given by Kato [16] in the case of Laplacian and extended in [2] to the case of elliptic operators with bounded measurable coefficients Kato classes relative to a subelliptic Laplacian...
- 19
- 326
- 0
A Woman with a mass in the liver pot
Ngày tải lên :
13/07/2014, 20:20
... neuroendocrine carcinoma chạy tới gan, ch a dùng chemotherapy agents mà thường dùng cho ch a ung thư thấy phổi, tức dùng combination Carboplatin etoposide "first line" - Kinh nghiệm "small cell cancer ... differentiated: carcinoid tumor hay pancreatic endocrine tumor (b) poorly differentiated có lẽ từ phổi (small cell cancer) Case khó chỗ: (1) tìm poorly diff neuroendocrine carcinoma, tức thuộc small cell ... (cecal mass) hay: thấy villous adenoma cắt sâu thấy chuyển sang poorly diff neuroendocrine carcinoma Tức : poorly diff neuroendocrine tumor từ cecum chạy tới gan (2) Bây xác nhận neuroendocrine...
- 4
- 249
- 0
Báo cáo lâm nghiệp: "Productivity and cost of manual felling with a chainsaw in Caspian forests" pptx
Ngày tải lên :
07/08/2014, 10:21
... Conduct a continuous time study on manual harvesting systems with a chainsaw model Stihl in a Caspian hardwood forest (2) Estimate the production rates and costs of chainsaw felling Material and ... Fagus orientalis, Carpinus betulus, Acer velutinum, Alnus subcordata and Ulmus glabra The canopy height averages approximately 26 m The manual harvesting system examined consisted of felling with ... Silvicultural system Kind of timber selection cutting beech, alder 97 Table Statistics of operational variables of the chainsaw felling in the study area Standard Variable mean deviation minimum maximum...
- 5
- 393
- 0
Báo cáo y học: "Tight perioperative glucose control is associated with a reduction in renal impairment and renal failure in non-diabetic cardiac surgical patients" ppsx
Ngày tải lên :
13/08/2014, 11:23
... Tripathy D, Garg R, Bandyopadhyay A, Calieri J, Hoffmeyer D, Syed T, Ghanim H, Aljada A, Dandona P: Anti-inflammatory and pro-fibrinolytic effect of insulin in acute ST-elevation myocardial infarction ... categories, Risk, Injury and Failure, according to plasma creatinine or estimated glomerular filtration rate and urinary output (Table 1) The estimated glomerular filtration rate was calculated, ... regression analysis and Student t test when appropriate Data are expressed as mean ± standard deviation (SD) for continuous variables and numbers and percentages for qualitative variables All p values...
- 12
- 245
- 0
Nonlinear vibration of a pendulum with a support in harmonic motion
Ngày tải lên :
08/04/2015, 15:30
... the case when differs a little from unity We are interested in finding out what happens close to resonance, that is to say when - is sm all, namely: - (5) = + (Jjd where A is a detuning parameter ... h e sta tio n a r y am p litu d e a and phase rjo are determ ined by hi~ia + C~I2 sin rjo = 0, ~ a U JẨ ( 11) + ~ a ị + C~12 cos r?o = A sim p le c a lc u la tio n elim in atin g T leads to ... tin g here ỉ/ = l / y / ã we have (28) — = a y /a + ( \ / a • a 3) We shall consider the principal reson ant case w h en the am plitude a takes values close to aQ d ete r m in e d by n £2 i/(a...
- 9
- 337
- 0
Báo cáo y học: " Non-syndromic multiple supernumerary teeth in a family unit with a normal karyotype: case report"
Ngày tải lên :
25/10/2012, 11:40
... Federation notation), as well as with the presence of an impacted supernumerary tooth (distomolar 4.9) The patient reported localized pain and a slight homolateral submandibular lymphadenopathy, without ... hard and soft surrounding structures Clinical case A 30 years old Caucasian patient came to our observation with five impacted teeth (1.8, 2.8, 3.8, 4.7 and 4.8, according with FDI World Dental ... hematological investigation and after the assessment of 380 radiographic exams, such as X-Ray Dental Panoramic Tomogram and Denta-Scan (Fig 6) of the inferior maxillary bone Exodontia led to remission...
- 7
- 597
- 0
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
Ngày tải lên :
26/10/2012, 09:07
... bupivacaine with or without Sarapin Group II = bupivacaine and steroids with or without Sarapin WC = Workers compensation MVA = Motor vehicle injury Analysis of Data Numbers Analyzed Data were analyzed ... interventions in managing chronic spinal pain Pain Physician 2009; 12: E71-120 Manchikanti L, Singh V, Pampati V, et al Is there correlation of facet joint pain in lumbar and cervical spine? Pain Physician ... AC, Wang SC, Bogduk N, et al Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Australian population with chronic low back pain Ann Rheum Dis 1995; 54: 100-6 Manchikanti...
- 12
- 669
- 0
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
Ngày tải lên :
03/11/2012, 10:52
... complex was precipitated with 100 µl of goat anti rabbit IgG and 10 µl of normal rabbit serum (Peninsula Laboratories Inc., San Carlos, CA) dissolved in RIA buffer After incubating at room temperature ... (HRP–conjugated anti–rabbit IgG, Santa Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human ... unleashing NMDA and AMPA excitotoxic injury Thus a mechanism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against spinal...
- 8
- 499
- 0
What To Do If Trapped In A Lift With A Dentist
Ngày tải lên :
14/11/2012, 16:50
... WOULDN'T WANT FOR CHRISTMAS A dead robin in a sock, a relaxation CD that appears to be voiced by Ian Paisley A pair of trainers pickled in bree A vague sense of inadequacy A perambulating hamster nailed ... cardboard in half and writing a windows error message to make the Mac users laugh Pretend you're using an i-pod by placing a bee in each ear and holding a gaudy pencil case to be in a pain in everyone's ... mistakes again and again and again WAR War what is it good for? Reinvigorating depressed economies and winning elections MIDDLE CLASS LAND Some live in middle class land with pensions a prime...
- 34
- 515
- 0
Approaches to Establish a Modeling WWTP with a Case Study in Qinghe WWTP
Ngày tải lên :
05/09/2013, 09:08
... validity of data Table show what kinds of instruments are needed in Qinghe WWTP Table.4 Collocation of online instruments in Qinghe WWTP Locatio Apparatus for Apparatus for water quality analysis ... conductance etc., and water quality analysis apparatus such as NH4+-N, PO43—P and COD etc The instruments should be maintained regularly, cleaned on time and calibrated periodically, to guarantee ... important to achieve the entire functions of operation control and administration In some WWTPs, wastewater analytical apparatuses and data transferring equipments are collocated sufficiently with...
- 9
- 675
- 0
A contrastive analysis of idioms denoting humans with dispraising implications in english and vietnamese
Ngày tải lên :
26/11/2013, 13:31
... however, are also known as the roughest part in vocabulary acquisition that learners of a foreign language in general and semantic features of English idioms denoting humans with dispraising implication ... conducted so as to draw out some implications with particular reference to the 3.5 DATA ANALYSIS After finishing the collection of data, we qualitatively describe, analyze and compare the data in two ... translating idioms a) English 3.8 SUMMARY [4] Adv + A + Prep (As cunning as a fox) [5] A + and + A (Meek and mild) b) Vietnamese Chapter [6] A + A (T cao t ñ i) FINDINGS AND DISCUSSION [7] A...
- 14
- 1.9K
- 4
A STUDY ON TECHNIQUES TO DEAL WITH NON EQUIVALENCE IN TRANSLATING ENGLISH IDIOMS INTO VIETNAMESE
Ngày tải lên :
11/12/2013, 23:53
... in the idioms have non-standard meaning Thus, in this analysis, we assume that these idioms, known as semantically decomposable idioms, can be paraphrased in a way that assigns a meaning to individual ... translation reproduces the matter without the manner, or the content without the form of the original Usually it is a paraphrased much longer than the original, a so-called intralingua translation, ... exist in the original *Communicative translation: Communicative translation attempts to render the precise contextual meaning of the original in such a way that both content and language are acceptable...
- 60
- 1.2K
- 7
Tài liệu RTehseaerc he axrtipcleerience of college students with pulmonary tuberculosis in Shaanxi, China: a qualitative study pptx
Ngày tải lên :
15/02/2014, 12:20
... the participants majored in medicine Data analysis Data collection Results The 17 participants' demographic characteristics are summarized in Table Three main themes were generated after analysis, ... took action to prepare for postgraduate study or going abroad But, I am behind in my study and can not anything I am so worried.' (Female, 22 years old, intensive phase, inpatient) 'Since I was absence ... organized into themes Disagreements were discussed among the research team to reach a final consensus The principal researcher revisited the main points of the findings with the participants and asked...
- 9
- 906
- 0
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf
Ngày tải lên :
18/02/2014, 04:20
... permeabilized and stained with polyclonal antibodies against furin and GRASP55 Arrows show examples of membrane compartment containing GRASP55 and furin Scale bar = 10 lm C GRASP55 Furin contrast, ... colleagues [35] GRASP55F in pCDNA3.1 Zeo+ contained a C-terminal FLAG tag Full-length GRASP55, GRASP55 PDZ1 (amino acids 1–107), GRASP55 PDZ2 (amino acids 84–172) and GRASP55 region (amino acids ... were annealed and inserted upstream of EYFP in pEYFP-N1 (Clontech-Takara Bio Europe, Saint-Germain-en-Laye, France) DNA coding for MT1-MMP hinge, hemopexin, stalk, transmembrane and cytoplasmic...
- 18
- 603
- 0