screening for ligands of c type lectin like receptors
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
Ngày tải lên :
24/03/2014, 03:21
... correspond to BS3 concentrations of 0, 0.16, 0.3, 0.6, 1.25, 2.5, 5, 10, and 20 mM, respectively (A) Intact AFP in the presence of CaCl2 (B) Deglycosylated AFP in the presence of CaCl2 (C) Intact AFP in ... characteristics of C- type lectins, especially those involved in the acute-phase response of host immune defense such as the collectins In such cases, multimerization Ó FEBS 2002 serves to enhance the ... review of the manuscript We also thank a number of IMB colleagues for their kind assistance, including Robert Richards for helpful discussion, Shawna MacKinnon for use of her HPLC, Denise LeBlanc for...
- 8
- 518
- 0
Báo cáo khoa học: The C-type lectin-like domain superfamily ppt
Ngày tải lên :
30/03/2014, 11:20
... to NK cell receptor complex (group V) Encodes several CTLDcps expressed by macrophages and dendritic cells: macrophage C- type lectin (MCL [148]), macrophage-inducible C- type lectin (Mincle [149]), ... the CRDs of the C- type lectins, or which have structure resembling the structure of the prototypic C- type lectin CRD Proteins harboring this domain will be called CTLDcontaining proteins (CTLDcps) ... members (including those from genome sequences only) from different animal species, most of which lack lectin activity Term definitions: CTLD, CRD, C- type lectin The terms C- type lectin , ‘carbohydrate...
- 39
- 515
- 0
Báo cáo y học: "Myeloid dendritic cells display downregulation of C-type lectin receptors and aberrant lectin uptake in systemic lupus erythematosus" pdf
Ngày tải lên :
09/08/2014, 13:22
... end, DCs express a number of pattern recognition receptors, which recognize specific molecular patterns exhibited on a variety of cell types and pathogens Among these are the C- type lectin receptors ... Diego, CA, USA) These mAbs include anti-CD1 1c, CD11b, CD14, CD16, CD32, CD64, CD209, CD206, CD40, CD80, CD83, CD86, and class Unlabeled zymosan A and zymosan A fluorescent BioParticles were purchased ... pattern recognition receptors such as Toll -like receptors DCs express a number of different membranebound CTLRs, which can function as pathogenic antigen-recognition and antigen-uptake receptors, ...
- 10
- 327
- 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt
Ngày tải lên :
23/03/2014, 13:20
... (5¢-GTCGAATTCCAAGGTG AAGAACCCCAG-3¢) was located at nucleotides 63–90 of the coding sequence, and the antisense primer (5¢-TG CTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢) overlapped the stop codon DNA sequencing ... N.S., SassoneCorsi, P., Brechot, C & Sobczak-Thepot, J (1995) Cell cycle regulation of cyclin A gene expression by the cyclic AMPresponsive transcription factors CREB and CREM Mol Cell Biol 15, ... clones of Chang cells stably expressing HIP/PAP (called HIP9 and HIP4) and two clones of Chang cells stably transfected with the empty vector (control clones called PC4 and PC8) Each assay was performed...
- 9
- 310
- 0
Tài liệu Báo cáo Y học: The Fc receptor c-chain is necessary and sufficient to initiate signalling through glycoprotein VI in transfected cells by the snake C-type lectin, convulxin ppt
Ngày tải lên :
22/02/2014, 07:20
... absence of the FcR c- chain This may reflect a speci c pathway of degradation that prevents expression of functionally uncoupled receptors in certain cell types The cotransfection of FcR c- chain ... noncovalently and constitutively associated with FcR c- chain in platelets [2], COS-7 cells were also cotransfected with the different constructs of GPVI and FcR c- chain Cotransfection of the FcR ... and FcR c- chain expression in K562 cells K562 cells were stably transfected with FcR c- chain together with empty vector (K562/ pRc -c) or coding for wild -type GPVI (K562/F1 -c) or a cytoplasmictail-depleted...
- 10
- 506
- 0
Báo cáo khoa học: The male seahorse synthesizes and secretes a novel C-type lectin into the brood pouch during early pregnancy pdf
Ngày tải lên :
07/03/2014, 17:20
... the following primers: forward, 5¢-CGCGGATCCTGGTCTTTCCAAAATATTC AGGCCA-3¢ and reverse, 5¢-GTCCTCGAGGTACATCA CATCTCTGAT-3¢ After digestion, the PCR-amplified fragment was cloned into a modified BamHI ... CV864030 CV864031 CV864032 Lectin C- type domain containing protein [C elegans] (5e-07) C- type lectin [A japonica] (4e-16) Leucine-rich repeat-containing protein [M musculus] (9e-79) CV864033 CV864034 ... precursor [S salar] (2e-20) CV863989 CV863990 CV863991 C- type lectin [A japonica] (6e-11) C- type lectin [A japonica] (2e-11) Similar to ATP synthase C, subunit C, isoform [D rerio] (1e-35) CV863992...
- 15
- 379
- 0
Báo cáo hóa học: "Multicriteria Gene Screening for Analysis of Differential Expression with DNA Microarrays" potx
Ngày tải lên :
23/06/2014, 01:20
... values according to (9) Select gene indices Ᏻ1 according to (3) Stage Construct simultaneous PCER CIs using (10) Select gene indices Ᏻ2 according to (5) For Stage of the screening procedure, we consider ... statistical and biological level of significance The statistical level of significance of the test is specified by the false positive rate In contrast, the biological level of significance of the ... none of the above approaches account for a MAD constraint or provide CIs on the differential expression levels of the discovered genes In contrast, our approach accounts for both FDR and MAD constraints...
- 10
- 297
- 0
Báo cáo y học: "Gene expression-based screening for inhibitors of PDGFR signaling" potx
Ngày tải lên :
14/08/2014, 08:20
... primers used for multiplex PCR reactions were: EGR1, 5'AGC GGA TAA CAC CTC ATA CCC ATC CCC TGT-3' and 5'AGC GGA TAA CTG TCC TGG GAG AAA AGG TTG-3'; c- fos, 5'-AGC GGA TAA CGC TTC CCT TGA TCT GAC TGG-3' ... 5'-AGC GGA TAA CAT GAT GCT GGG AAC AGG AAG-3'; ATP5B, 5'-AGC GGA TAA CCA AAG CCC ATG GTG GTT ACT3' and 5'-AGC GGA TAA CGC CCA ATA ATG CAG ACA CCT3'; RPL23A, 5'-AGC GGA TAA CAA GAA GAA GAT CCG CAC ... GTC-3' and 5'-AGC GGA TAA CCG AAT CAG GGT GTT GAC CTT-3' The following primers were used for single-base extension reactions: EGR1, 5'-TTC CCC CTG CTT TCC CG-3'; c- fos, 5'TGC CTC TCC TCA ATG ACC...
- 14
- 302
- 0
SPECIFIC HEAT AT CONSTANT VOLUME FOR CRYOCRYSTALS OF NITROGEN TYPE
Ngày tải lên :
30/10/2015, 19:59
... in Sec.III II THEORY OF SPECIFIC HEAT AT CONSTANT VOLUME FOR MOLECULAR CRYOCRYSTAL OF NITROGEN TYPE II.1 Theory of vibrational specific heat at constant volume for crystal with cubic structure ... SPECIFIC HEAT AT CONSTANT VOLUME FOR CRYOCRYSTALS OF NITROGEN TYPE 229 the self-consistent field method in the study of specific heat at constant volume of crystals of nitrogen type taking account ... rotations from SCFM, Cvvib is the specific heat Cv taking account of only lattice vibrations from SMM, Cvrot + Cvvib is the specific heat Cv taking account of both lattice vibration and molecular rotations...
- 7
- 193
- 0
Tài liệu Association of killer cell immunoglobulin-like receptors with pulmonary tuberculosis in Chinese Han pdf
Ngày tải lên :
15/02/2014, 12:20
... 2DS2-2 CGGGCCCCACGGTTT GGTCACTCGAGTTTGACCACTCA 240 2DS3-1 TGGCCCACCCAGGTCG TGAAAACTGATAGGGGGAGTGAGG 242 2DS3-2 CTATGACATGTACCATCTATCCAC AAGCAGTGGGTCACTTGAC 190 2DS4-1 CTGGCCCTCCCAGGTCA TCTGTAGGTTCCTGCAAGGACAG ... TCTGTAGGTTCCTGCAAGGACAG 204 2DS4-2 CTGGCCCTCCCAGGTCA GGAATGTTCCGTTGATGC 2000 2DS5 TGATGGGGTCTCCAAGGG TCCAGAGGGTCACTGGGC 125 2DS1-1 CTTCTCCATCAGTCGCATGAA CTTCTCCATCAGTCGCATGAG 102 2DS1-2 CTTCTCCATCAGTCGCATGAA ... GAGGGGGAGGCCCATGAAT TCGAGTTTGACCACTCGTAT 150 2DL3-1 CTTCATCGCTGGTGCTG AGGCTCTTGGTCCATTACAA 550 2DL3-2 TCCTTCATCGCTGGTGCTG GGCAGGAGACAACTTTGGATCA 800 2DS2-1 TTCTGCACAGAGAGGGGAAGTA CTTCTCCATCAGTCGCATGAG...
- 9
- 402
- 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
Ngày tải lên :
23/03/2014, 04:21
... increasing concentrations of each sugar For the progressive chemical-shift changes of EW29Ch under conditions of fast exchange on the chemical-shift timescale, 15N and 1HN chemical-shift changes ... each of the two sugar-binding sites (a and c) of EW29Ch had a distinct chemical exchange on the chemical-shift timescale Site-speci c dissociation constants determined by NMR The site-speci c ... EW29Ch molecule of the crystal structure (each crystal contained two molecules A and B) the interaction between the glucose residue and subdomain c of EW29Ch was not observed; (b) the B-factor of...
- 11
- 458
- 0
Báo cáo khoa học: Structural basis for the recognition of complex-type biantennary oligosaccharides by Pterocarpus angolensis lectin ppt
Ngày tải lên :
23/03/2014, 11:20
... Data bank of three-dimensional structures of disaccharides: Part II, N-acetyllactosaminic type N-glycans Comparison with the crystal structure of a biantennary octasaccharide Glyconconj J 8, ... side chain of Glu221 is completely disordered in the ligand-free structure Crystal structure of the NA2F decasaccharide complex The decasaccharide Galb(1–4)GlcNAcb(1–2)Mana(1– 6)[Galb(1–4)GlcNAcb(1–2)Mana(1–3)]Manb(1–4)GlcNAcb(1–4)[Fucb(1–6)]GlcNAc ... for GlcNAcb(1–2)Man in the binding site of subunit A of PAL (B) Interactions of PAL with GlcNAcb(1–2)Man The protein is coloured according to atom type The disaccharide is colored green Selected...
- 14
- 444
- 0
Báo cáo y học: "Efficiency of vibration exercise for glycemic control in type 2 diabetes patients."
Ngày tải lên :
26/10/2012, 10:04
... beneficial effect of vibration-exercise on glycemic control without detectable changes in physical performance parameters A dominant influence of body weight changes appears unlikely since weight ... [9,12] Secondly, a single bout of muscle contractions leads to a translocation of GLUT-4 to the sarcolemmal membrane, which acutely enhances glucose transport capacity [6,7,11] Evidence of acute ... force transducer (Digimax© , Mechatronic Ltd) was used and the lever arm calculated as the distance between knee joint space and contact point of force transduction The best of three trials of...
- 5
- 544
- 0
Diabetes Type 2 - Screening for Diabetes and Circulation System Disease in Obese Children
Ngày tải lên :
16/01/2014, 14:27
... screening- http://thomsonlifestylecentre.com/pre-marital-health -screening Educated customers have forced food companies to supply low-body fat cheeses Clearly, the issue of Diabetes type and heart and circulation system ... assertive campaign of public education within the 1980's also it seems to become having to pay off School lunches are supplied and workout is incorporated being an important school activity Youngsters ... youthful people could be solved with healthy school lunches and education Diabetes type isn't a condition your son or daughter must just accept By looking into making simple changes for your child's...
- 3
- 342
- 0
Tài liệu Real-Time Digital Signal Processing - Appendix C: Introduction of C Programming for DSP Applications ppt
Ngày tải lên :
25/01/2014, 19:20
... C: INTRODUCTION OF C PROGRAMMING FOR DSP APPLICATIONS C program (Source) Preprocessor Compiler Assembly code Assembler Object code Linker (loader) Libraries Execution Data Output Figure C. 1 C. 1 ... interpret include files, and check conditional compilation Preprocessor directives give instructions to the compiler that are performed before the program is compiled Each preprocessor directive begins ... the C compiler The #define directs the preprocessor to replace subsequent occurrences of K with the constant value 1024 A C program may consist of one or more functions and one and only one function...
- 18
- 505
- 0
The screening recommendations for cancer of the breast
Ngày tải lên :
27/01/2014, 08:52
... breast screening - http://thomsonlifestylecentre.com/breast-cancer -screening- package The American Cancer Society recently launched new cancer of the breast screening recommendations The ... employed additionally to some mammogram, not instead of Learn more at cancer screening http://thomsonlifestylecentre.com/breast-cancer -screening- package ... the benefits and drawbacks of adding a yearly MRI There's no proof that MRI is an efficient screening tool for ladies of average risk - For ladies at high-risk, MRI screening must start at 30...
- 2
- 277
- 1
Tài liệu Báo cáo khoa học: Angiopoietin-like proteins: emerging targets for treatment of obesity and related metabolic diseases pptx
Ngày tải lên :
14/02/2014, 22:20
... proliferator-activated receptor (PPAR )c agonists used in clinical practice effectively ameliorate adipose tissue inflammation and systemic insulin sensitivity, they have potential side effects, such as increased ... (particularly visceral obesity) and correlated with the levels of systemic insulin resistance and inflammation [15] Circulating ANGPTL2 levels decrease with body weight reduction, likely reflecting ... (tumor necrosis factor-a, interleukin-6 and interleukin-1b) was increased in the adipose tissue of ANGPTL2 transgenic mice compared with that of wild -type mice [15] Conversely, ANGPTL2 null mice fed...
- 6
- 609
- 0
Tài liệu Báo cáo khoa học: Biosynthesis of riboflavin Screening for an improved GTP cyclohydrolase II mutant pdf
Ngày tải lên :
18/02/2014, 11:20
... study Oligonucleotide Nucleotide sequence (5¢- to 3¢) ribA3S ribA4AS ribA1S ribA2AS TCGCGAAAAAGCATCAATTAAAAATG TAATTAAGCTTGGATCCTTAG; TAACAATTTCACACAGAATTC GATGCTTTTTCGCGATTTCAATGAGC nucleotide triphosphates, ... sites of pQE60 (Table 1) The gene itself was slightly modified by the addition of the DNA sequence motif 5¢-GAA TTCattaaagaggagaaattaact ATG AGA GGA TCT CAC CAT CAC CAT CAC CAT GGG ATC GAT CAT-3¢ ... range of substrate concentrations (0.017–1.7 mm) The Vmax value of Construct C exceeded that of the wild -type protein by a factor of 1.9 Constructs C and E both showed Km values that were increased...
- 11
- 487
- 0
Báo cáo khoa học: A novel mechanism of V-type zinc inhibition of glutamate dehydrogenase results from disruption of subunit interactions necessary for efficient catalysis doc
Ngày tải lên :
05/03/2014, 23:20
... effect of zinc is on Vmax, there is little or no effect on the affinity for reduced cofactor in the enzyme–glutamate–reduced cofactor complexes In the absence of glutamate zinc appears to significantly ... absence of enzyme and the incremental fluorescence DF at each NADH concentration was calculated where DF is the fluorescence in the presence of enzyme minus the fluorescence in the absence of enzyme ... to be calculated Fluorescence measurements were made using an Thermospectronic Aminco-Bowman spectrofluorimeter Reduced cofactor binding was studied using fluorescence titrations of fixed concentrations...
- 12
- 544
- 0
Báo cáo khoa học: C fi G base mutations in the CArG box of c-fos serum response element alter its bending flexibility Consequences for core-SRF recognition potx
Ngày tải lên :
07/03/2014, 09:20
... (1989) Effect of the G–T mismatch on backbone and sugar conformation of Z-DNA and B-DNA: analysis by Raman spectroscopy of crystal and solutions structures of d(CGCGTG) and d(CGCGCG) Biochemistry ... Fluorescence emission spectrum of fluorescein (—) Fluorescence emission spectrum of fluorescein conjugated to SREfos (e) Both spectra are normalized The fluorescence emission spectra of fluorescein conjugated ... Analysis of the crystal structure of speci c complexes reveals that core-SRF modulates the inducible conformational properties of SRE [23,24] The origin of the adequate conformational deformation of...
- 16
- 538
- 0