schrödinger equation in a central potential
báo cáo hóa học: " An initial-boundary value problem for the one-dimensional non-classical heat equation in a slab" potx
Ngày tải lên :
21/06/2014, 02:20
... Universidad Austral, Paraguay 1950, S2000FZF Rosario, Argentina 4Facultad de Ingenier a, Universidad Nacional de Salta, Buenos Aires 144, 4400 Salta, Argentina Salva et al Boundary Value Problems 2011, ... one-dimensional heat equation Addison-Wesley Publishing Company, Menlo Park, CA (1984) 14 Miller, RK: Non lineal Volterra Integral Equations W .A Benjamin, Inc., California (1971) 15 Friedman, A: Partial ... Volterra integral formulation for problems (1.1) to (1.4) In Section 3, and 5, boundedness, comparisons results and asymptotic behavior regarding particular initial and boundary data are obtained In...
17
520
0
Báo cáo y học: "In-vivo evaluation of simultaneous administration of incompatible drugs in a central venous catheter with a decreased port to port distance" pps
Ngày tải lên :
12/08/2014, 18:20
... followed by a ml normal saline flush The TPN solution (Table 1), with a pH of 5.8, was administered simultaneously through the medial lumen at the standard clinical maintenance rate calculated in ml/kg/day ... 11.6% and 53% in two separate studies [7,8] Leakage and extravasation of drugs and fluids can have major consequences for the patient Local edema, inflammation, infection, and necrosis are the ... identified, and the incision was extended to isolate and retract peritoneal contents exposing the retroperitoneal vasculature The iliac vessels and the inferior vena cava were dissected and isolated Sampling...
3
231
0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
Ngày tải lên :
24/03/2014, 04:21
... TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢ C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢ C-213S: 5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢ C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢ ... 2890 E Mattern-Dogru et al (Eur J Biochem 269) CCATAGCTTTGGTGGCATGAGTTTGGG-3¢ S8 7A: 5¢-GTTCTTCTTGGCCATAGCTTTGGTGGCATGAG TTTGGG-3¢ H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢ D21 6A: 5¢-G ... (Darmstadt, Germany) and diethylpyrocarbonate (DEPC) was from AppliChem (Darmstadt, Germany) All solvents and chemicals were of analytical grade and obtained from Merck (Darmstadt, Germany), Sigma (Deisenhofen,...
8
345
0
Báo cáo hóa học: " Research Article Infinitely Many Solutions for a Semilinear Elliptic Equation with Sign-Changing Potential" potx
Ngày tải lên :
21/06/2014, 20:20
... Variations and Partial Differential Equations, vol 23, no 2, pp 139–168, 2005 W Kryszewski and A Szulkin, “Generalized linking theorem with an application to a semilinear Schrodinger equation, ” Advances ... Boundary Value Problems a nontrivial solution of P in a situation where f x, u and V x are periodic in the xvariable, f x, u is superlinear at u and ±∞, and lies in a spectral gap of −Δu V If in ... and Continuous Dynamical Systems, vol 7, no 4, pp 703–718, 2001 G Cerami, G Devillanova, and S Solimini, In nitely many bound states for some nonlinear scalar field equations,” Calculus of Variations...
7
375
0
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
Ngày tải lên :
08/03/2014, 23:20
... stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton ... CoA CoB CoC DaB EaA EaB EsB FhA FhB HaA HaB HoA HoB HoC HvB HvC MaA MaB MaC MbA MbB MbC Md MhB MhC MhD Mn MoA MoB MrB Allagash Allagash Allagash Allagash Canadaigua silt loam, thin solum Caribou ... kame terrace Glaciolacustrine originating as a blanket formation and a deltaic formation Colluvium originating on a kame terrace Organic swamp originating as a blanket formation Residuum originating...
131
599
0
Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc
Ngày tải lên :
16/03/2014, 06:20
... multiple catalytic domains have been identified – two-domain arginine kinases [19–21], a two-domain carbonic anhydrase [22], a three-domain luciferase [23] and a threedomain adenylate kinase [24] ... separate individual domains: D1, MfeI and XhoI; D2, XhoI and AatII; D3, AatII and AvrII PCR using Ex Taq HS polymerase (Takara USA, Santa Ana, CA, USA) was performed to fill in the sticky ends and ... using a QiaQuick spin kit (Qiagen, Valencia, CA, USA) This product was subcloned into a Catalysis in a contiguous trimeric creatine kinase puC19 TA (TOPO) cloning vector (Invitrogen, Carlsbad,...
9
567
0
Central Bank Interest-Rate Control in a Cashless, Arrow-Debreu economy: a comment on Wallace pptx
Ngày tải lên :
22/03/2014, 17:20
... level or inflation, nominal interest rate rules or justifying a role for the central bank Nominal magnitudes are nominal in name only and Wallace’s analysis is without theoretical foundations It ... that the central bank can make an arbitrarily chosen R a necessary condition for a CE N Claim Assume ∑e n t = and et0 > for t =1, For any real R the central bank n −1 (agent 0) can behave as a ... the central bank and interest rate control in the cashless, Arrow-Debreu economy is of no analytical or theoretical significance What the central bank does in this world, assuming that it can in...
21
219
0
Báo cáo khoa học: Contribution of a central proline in model amphipathic a-helical peptides to self-association, interaction with phospholipids, and antimicrobial mode of action ppt
Ngày tải lên :
23/03/2014, 10:21
... In summary, we have demonstrated that a central Pro in amphipathic a- helical peptides effectively disrupts their a- helical structures and aggregation in buffer but that they maintain a- helical ... contained saturated a- cyano-4-hydroxycinnamic acid in 50% acetonitrile ⁄ 0.1% trifluoroacetic acid Determination of antimicrobial activity The antimicrobial activity of peptides against a range ... Ala in the hybrid analog P18 decreases its antibacterial activity and increases its hemolytic activity [39] In general, introduction of a Pro near the central region of a- helical antimicrobial...
15
376
0
Central-Bank Interest-Rate Control in a Cashless, Arrow-Debreu Economy pot
Ngày tải lên :
29/03/2014, 01:20
... central bank, to choose the nominal interest rate One way to think of a central bank as enforcing a particular magnitude for the nominal interest rate is to have it offer to buy date-1 ecus for date-2 ... as the central bank’s sale (purchase if negative) of t t date-t ecus Then, (2) says only that the central bank trades at a price Because the central bank does not maximize utility in any ordinary ... the central bank can make an arbitrarily chosen R a necessary condition for a CE P ˆ Claim Assume N en = and e0 > for t = 1, For any R ∈ R++ , t n=1 t the central bank (agent 0) can behave as a...
8
277
0
Báo cáo khoa học: The domains carrying the opposing activities in adenylyltransferase are separated by a central regulatory domain ppt
Ngày tải lên :
30/03/2014, 08:20
... deadenylylation active site [13] Assay data obtained using various truncation constructs indicated that the central domain acted as a regulatory domain (see later) Indirect evidence from equivalent ... structure of adenylyltransferase Inhibition of PII binding in adenylylation by R domain mAbs Similarly, the two R domain mAbs, 39G11 and 5A7 , were used in adenylylation assays with AT and AT-C:432–946 ... the primary antibodies were visualized with alkaline phosphatase-conjugated secondary antibodies following incubation in an alkaline phosphatase buffer containing nitroblue tetrazolium and 5-bromo-4-chloro-3indolyl...
13
337
0
Báo cáo khoa học: Cyclosporin A-induced oxidative stress is not the consequence of an increase in mitochondrial membrane potential doc
Ngày tải lên :
30/03/2014, 08:20
... presented in Fig 3C suggest increases in cytosolic [Ca2+] in response to CsA and its analogs Both the intracellular Ca2+ chelator BAPTA and the extracellular Ca2+ chelator EGTA caused significant attenuation ... quantified by using a chemiluminescent ATP assay Mitochondrial respiration rate was measured using an oxygraph DCF (1 lgÆmL)1) was used to quantify ROS Data are expressed as mean value ± SEM and ... that CsA induces oxidative stress, but its origin remains speculative Mitochondria represent a major source of intracellular ROS, and play a crucial role in cellular Ca2+ homeostasis, which affects...
10
455
0
escobedo m., mischler s., valle m.a. homogeneous boltzmann equation in quantum relativistic kinetic theory
Ngày tải lên :
24/04/2014, 17:14
... mathematical questions about Boltzmann equations for quantum particles, relativistic and not relativistic The general interest in different models involving that kind of equations has increased ... that f f in L1 ∩ L∞ , and any sequence (a ) satisfying (3.8) uniformly in and such that a → a a.e In particular, under the assumption (3.8) on B and taking a = B , a = B, it is possible to pass ... sphere case w = As it is indicated by the remark above, the estimates at our disposal in this case are even better than in the classical case In particular the collision term Q(f ) may be defined in...
85
305
0
Báo cáo hóa học: "Rac1-mediated signaling plays a central role in secretion-dependent platelet aggregation in human blood stimulated by atherosclerotic plaque" ppt
Ngày tải lên :
18/06/2014, 16:20
... By using NSC23766, our group recently unraveled a Ca2+ -dependent pathway regulating secretion in thrombin-stimulated human platelets linking Rac1 activation to actin dynamics: Calcineurin®Rac1 ... Such a broad inhibitory profile of a Rac1 inhibitor suggests that pharmacological targeting of Rac1 is an interesting approach for developing future antiplatelet drugs Methods Materials Acetylsalicylic ... was added to the anticoagulant [17] The final concentration of ASA in the blood was mM Platelet aggregation and ATP-secretion in blood Whole blood platelet aggregation was determined by impedance...
10
441
0
Báo cáo sinh học: "Shipping blood to a central laboratory in multicenter clinical trials: effect of ambient temperature on specimen temperature, and effects of temperature on mononuclear cell yield, viability and immunologic function" potx
Ngày tải lên :
18/06/2014, 19:20
... were thawed and rested overnight at 37°C before staining with CD4, CD8, Annexin V and 7-AAD The viable populations were defined as Annexin V negative and 7AAD negative and are expressed as a percentage ... of the manuscript and editing EF assisted in the gathering and organization of shipping data RJF was instrumental in concept of study ARC assisted in the in vitro studies and data analysis JHF ... suspended in PBS (Invitrogen) containing 0.1% BSA (Sigma) and 0.1% sodium azide (Sigma) Titrated amounts of each reagent were added to cells, incubated, washed free of excess stain, and fixed in paraformaldehyde...
13
606
0
Báo cáo sinh học: "Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach" pdf
Ngày tải lên :
18/06/2014, 22:20
... Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach Hassan Azadi Kenary1 , Choonkil Park∗2 , Hamid Rezaei1 and Sun Young Jang3 Department ... Isac, G, Rassias, ThM: Stability of Functional Equations in Several Variables Birkh¨user, a Basel (1998) [23] Jung, S: Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis ... an additive mapping near an approximately additive mapping? In 1941, Hyers [19] gave a partial a rmative answer to the question of Ulam in the context of Banach spaces In 1978, Rassias [20] extended...
20
422
0
báo cáo hóa học:" Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach" pot
Ngày tải lên :
20/06/2014, 04:20
... Stability of a generalized quadratic functional equation in various spaces: a fixed point alternative approach Hassan Azadi Kenary1 , Choonkil Park∗2 , Hamid Rezaei1 and Sun Young Jang3 Department ... Isac, G, Rassias, ThM: Stability of Functional Equations in Several Variables Birkh¨user, a Basel (1998) [23] Jung, S: Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis ... an additive mapping near an approximately additive mapping? In 1941, Hyers [19] gave a partial a rmative answer to the question of Ulam in the context of Banach spaces In 1978, Rassias [20] extended...
20
291
0
Báo cáo hóa học: " A fixed point approach to the Hyers-Ulam stability of a functional equation in various normed spaces" pptx
Ngày tải lên :
20/06/2014, 22:20
... (2002) Kenary, HA: The probabilistic stability of a Pexiderial functional equation in random normed spaces Rend Del Circolo Math Di Palermo (to appear) Kenary, HA, Shafaat, Kh, Shafei, M, Takbiri, ... C*-ternary rings Taiwan J Math 13, 1985–1999 (2009) 11 Saadati, R, Vaezpour, M, Cho, Y: A note to paper “On the stability of cubic mappings and quartic mappings in random normed spaces” J Inequal Appl ... and Y a complete non-Archimedean normed space Assume that |m| ≠1 Lemma 3.1 Let X and Y be linear normed spaces and f : X ® Y a mapping satisfying (1) Then f is an additive mapping Proof Letting...
14
479
0
Báo cáo hóa học: " Uniqueness of the potential function for the vectorial Sturm-Liouville equation on a finite interval" doc
Ngày tải lên :
20/06/2014, 22:20
... H) can be obtained by applying inverse spectral theory for scalar Sturm-Liouville equation Unfortunately, it is not true We say Lm(Q, h, H) diagonal if all Q, h and H are diagonals ˜ Corollary ... New Taipei City 25137, Taiwan, PR China 2Department of Electronic Engineering, China University of Science and Technology, No.245, Academia Rd., Sec 3, Nangang District, Taipei City 115, Taiwan, ... China Authors’ contributions Both authors contributed to each part of this work equally and read and approved the final version of the manuscript Competing interests The authors declare that...
8
391
0
Xem thêm