sanctions in a regulatory context

... Ruiz-Sanz, Diana Romanini, Mauricio Javier Braia, Mar a Cecilia Porfiri, Ruel E McKnight, Stefka G Taneva, Sonia Bañuelos, Mar a A Urbaneja, Amal A Elkordy, Robert T Forbes, Brian W Barry, Laura ... crystals The Tg value after an annealing treatment can be taken as an indicator for the occurred changes in an amorphous/crystal ratio but also in PLA/filler interaction level The increase of an interfacial ... Gries, Eliane Lopes Rosado, Vanessa Chaia Kaippert, Roberta Santiago de Brito, R F B Gonçalves, J A F F Rocco, K Iha, Kazu-masa Yamada, Daniel Plano, Juan Antonio Palop, Carmen Sanmartín, Jindřich...

Ngày tải lên: 06/03/2014, 22:20

... Anoop Sarkar, Kenji Yamada, Alex Fraser, Shankar Kumar, Libin Shen, David Smith, Katherine Eng, Viren Jain, Zhen Jin, and Dragomir Radev 2003 Syntax for Statistical Machine Translation: Final report ... and Maria Giagkou 2011 Towards using web-crawled data for domain adaptation in statistical machine translation In Proceedings of the 15th Annual Conference of the European Associtation for Machine ... 28–35, Barcelona, Spain Taro Watanabe, Jun Suzuki, Hajime Tsukada, and Hideki Isozaki 2007 Online large-margin training for statistical machine translation In Proceedings of the 2007 Joint Conference...

Ngày tải lên: 24/03/2014, 03:20

... subordinate clause has no special rhetorical role in a discourse, but acts instead as a temporal adverb Such instances are less problematic for classical approaches than cases like (1,2b), but at ... third stage of processing, as with (2b), both binding and accommodating V to a fail, and so we assume (1",6, 7) The laws that apply are: Narration, States Overlap and the Charm Law The Charm Law is ... S ~¢ V can't bind to the context, and so we assume (a, a, 7), and the laws that apply are: Narration and States Overlap But inferring Background via the Cascaded Penguin ({es,ts}, { charm(., ~,...

Ngày tải lên: 24/03/2014, 05:21

... welfare, but is instead about both making and maintaining positive, healthy, reciprocal relationships A mature perspective on relationships also demands that individuals accept the obligations and ... limitations, and interests; identifying available options and ways to take advantage of them; and, most importantly, being able to set goals that are a good and realistic match to abilities – but also having ... ordering in terms of early adult indicators of economic well-being and health by the age of 31 and 32 We examined college graduation, earnings, savings, and financial difficulties as well as physical...

Ngày tải lên: 29/05/2014, 15:46

... Quantitative Studies Paul Norman, Meaghan L O’Donnell, Mark Creamer and Jane Barton Part Chapter 13 Stress Management Training 211 247 269 The Potential of Stress Management Training as a Coping ... atomic bombings of Hiroshima and Nagasaki, natural disasters (such as earthquakes, hurricanes, and volcano eruptions) and human-made disasters (such as factory explosions, airplane crashes, and ... University Faculty of Medicine, Northern Uganda, Gulu, Uganda XI Part Overview of Clinical Aspects Post Traumatic Stress Disorder – An Overview Amarendra Narayan Prasad Ministry of Defence (Indian Army),...

Ngày tải lên: 27/06/2014, 15:20

... represents 46% of all datasets and contains tumors from a diversity of anatomical locations, including lung carcinomas, bladder cancers, hepatocellular carcinomas and the hematological malignancy T-cell ... healing program might be effective against both ovarian and renal carcinoma, but not against Wilms' tumor or lung adenocarcinoma Interestingly, a recent paper that examined gene expression in ... guidance and participated in the preparation of the manuscript CJB, AP, KF and KN performed the experimental work Additional data files The following additional data are available Additional data...

Ngày tải lên: 14/08/2014, 20:22

... Brisbane, Australia She was educated in China and Australia in interpreting and translation, linguistics, and law She has published in the areas of translation theory, Chinese legal translation and ... Imperial Australia-New Zealand Army Corps at Gallipoli, as a defining national moment, an important part of a heritage to be shared by all who wish to be considered truly Australian In mining company ... writes about a garden of forking paths.1 This is a story that can be read in different ways It can be read as a detective novel, in which the reader is accompanying the main character in a murder investigation...

Ngày tải lên: 13/10/2016, 11:23

... recently, abnormally high brain levels of PA have been reported in a murine model of cerebral malaria, a frequently fatal complication of Plasmodium falciparum infection; in the same model, pharmacological ... potential interest to reduce life-threatening complications of cerebral malaria, and as an important tool in validating our proposal of hACMSD as a novel drug target for the treatment of diabetes and ... Regulation of mouse hepatic a- amino-b-carboxymuconate-e-semialdehyde decarboxylase, a key enzyme in the tryptophan–nicotinamide adenine dinucleotide pathway, by hepatocyte nuclear factor 4a and...

Ngày tải lên: 18/02/2014, 06:20

... ethambutol Nat Med 3, 567–570 30 Amemura M, Makino K, Shinagawa H & Nakata A (1990) Cross talk to the phosphate regulon of Escherichia coli by PhoM protein: PhoM is a histidine protein kinase and catalyzes ... 12 Gopalaswamy R, Narayanan PR & Narayanan S (2004) Cloning, overexpression, and characterization of a serine ⁄ threonine protein kinase pknI from Mycobacterium tuberculosis H37Rv Protein Expr ... phosphoprotein-binding domain Proc Natl Acad Sci USA 96, 7821–7826 32 Chopra P, Singh A, Koul A, Ramachandran S, Drlica K, Tyagi AK & Singh Y (2003) Cytotoxic activity of nucleoside diphosphate kinase secreted...

Ngày tải lên: 16/03/2014, 14:20

... each categorial level has a phonological level associated with it As we are mainly interested in the morphological aspects, we leave the phonological claims for what they are: within SPRAAKMAKER, ... the training set: for one thing, it must have a reasonable size and be representative of the domain that is being modelled Our training set was the CELEX database which contains approximately ... a production rule is going to appear anywhere in a sample of the language, and production rules are not always context- free [Magerman and [van den Bosch and Daelemans, 1993] A van den Bosch and...

Ngày tải lên: 18/03/2014, 02:20

... unspliced pgRNA and the SP1 splicing variant of HBV, primers SP1 (tgcccctatcctatcaacac), SP2 (actcccataggaattttccgaaa) and U2 (ttccaatgaggattaaagacag) were used Quantification of the splicing ratio by ... identified ISSs are S-AS ISSs, suggesting that the splicing regulatory mechanism associated with the sequence-independent S-AS repression is general in maintaining intact HBV transcripts The alignment ... proteins, a family of proteins containing one or two RNA-binding domains and a signature RS domain rich in Arg ⁄ Ser dipeptides, and splicing silencers usually recruit heterogeneous nuclear RNPs, a set...

Ngày tải lên: 28/03/2014, 23:20

... the information the chart has As a matter of fact, our PGS can be seen as a denotational variant of the chart, and it is managed in a different way by the PG Processor since in the PGS we mainly ... NaturaI Language MIT Press, Cambridge, MA Marino, Massimo (1988) A Process-Activation Based Parsing Algorithm for the Development of Natural Language Grammars Proceedings of 12th International ... for Natural Language American Journal of ComputationalLinguistics Microfiche 47, pp 296 Kaplan, Ronald, M (1973) A General Syntactic Processor In Randall Rustin, ed., Natural Language Processing,...

Ngày tải lên: 31/03/2014, 18:20

... use of context in elderly activity analysis They proposed a method for learning models of spatial context from tracking data A standard overhead camera was used to get tracking information and to ... like walking, sitting, standing up, bending and falling [12] Some application areas that involve visual activity analysis include behavioral biometrics, content-based video analysis, security and ... elderly activity analysis It may also be used in other research areas An interesting example may be traffic analysis; the road can be modeled as an activity zone For such modeling, complete training...

Ngày tải lên: 20/06/2014, 21:20

... important driving force in evolution [6], and there are many studies showing that genes preferentially expressed in males, and in the testis in particular, are rapidly evolving in the vertebrates ... in wings and thermal homeostasis in both mammals and birds, the vast bulk of comparative anatomy data reveals the deep roots of tissues and organ systems Morphology indicates that the basic sensory, ... while maintaining the expression of critical well-adapted ‘terminal’ functions like sperm and eggs, then maybe organ geneexpression patterns can also be maintained with different underlying sets...

Ngày tải lên: 06/08/2014, 19:20

... the final manuscript Available online http://arthritis-research.com/content/9/2/R32 Additional files The following Additional files are available online: Additional file A DOC file containing ... HD Shin and SC Bae have made substantial contributions to study design, acquisition of data, drafting the manuscript, and analysis and interpretation of data YK Sung and CB Choi have been involved ... Arthritis Research & Therapy Vol No Shin et al laboratory data were obtained: sex, age, ages at onset of first symptom and clinical diagnosis, ACR diagnosis, and Systemic Lupus International...

Ngày tải lên: 09/08/2014, 10:20

... pairs, containing 171 genes A B A B′ Figure thaliana A comparison of the arrangements of overlapping gene pairs in Arabidopsis A comparison of the arrangements of overlapping gene pairs in Arabidopsis ... Higgins J, Jotham J, May S: NASCArrays: a repository for microarray data generated by NASC's transcriptomics service Nucleic Acid Res 2004:D575-D577 NASCA Arrays: Affymetrix ATH1 arrays database ... individual candidate loci for a detailed molecular analysis of the different dsRNA pathways Materials and methods Analysis of overlapping transcripts All Arabidopsis genome information, including gene...

Ngày tải lên: 14/08/2014, 14:21

... setting, for example a parliament meeting of Canada or Belgium Combining these two analytical criteria of setting and interaction, we can conceive of interpreting as a conceptual spectrum extending ... regarded as a translational activity, as a special form of ‘Translation' (the capital initial is used to indicate that the word appears in its generic sense, as opposed to ‘written translation’, ... analysis, further categories may be added A global description or evaluation may be obtained only by taking into account these four mail areas without analyzing single categories The sheet may...

Ngày tải lên: 02/03/2015, 14:17

... this example was motivated by a debate on such an issue in the context of the forthcoming creation of a marine national park in the Iroise sea, a coastal sea west of Brittany (France) This area is ... stock and using a global discrete-time logistic model, Lauck et al [1998] have advocated marine reserves as a way of implementing the precautionary principle in fisheries management Also using a global ... Manage 28, 249 259 D Davis and V Harriott, et al [1995], Conflicts in a Marine Protected Area: Scuba Divers, Economics, Ecology and Management in Julian Rocks Aquatic Reserve, Australian Parks and...

Ngày tải lên: 04/03/2015, 10:25

... customers in over 50 countries around the world such as America, Canada, Europe (Britain, 40 GaMBA01.C0509-Group France, Germany, Portugal, Spain ), Asia (Japan, Korea, Hong Kong, Singapore, Malaysia, ... have lower labor costs, China as Bangladesh, Sri Lanka and Vietnam have started to expand market share Besides, many large import market in the world such as USA, EU and Japan also wants to reduce ... Take advantage, skills attracting a large - Organize programs to number of employees the local encourage consumers in manufacturing to open additional agents, bringing goods facilities in large...

Ngày tải lên: 26/03/2015, 10:56

Ngày tải lên: 26/03/2015, 10:59