sample letter to a judge for a traffic ticket

sam harris - letter to a christian nation

sam harris - letter to a christian nation

... notions about God and Paradise? The truth is, some of your most cherished beliefs are as embarrassing as those that sent the last slave ship sailing to America as late as 1859 (the same year that Darwin ... Testament, Jesus can be read to endorse the entirety of Old Testament law For truly, I say to you, till heaven and earth pass away, not an iota, not a dot, will pass from the law until all is accomplished ... pregnant, to have a baby, or to get an abortion Young Americans are also far more likely to be infected by HIV and other sexually transmitted diseases The rate of gonorrhea among American teens...

Ngày tải lên: 05/06/2014, 10:58

40 316 0
Báo cáo khoa học: "A Ranking Approach to Stress Prediction for Letter-to-Phoneme Conversion" doc

Báo cáo khoa học: "A Ranking Approach to Stress Prediction for Letter-to-Phoneme Conversion" doc

... lexical database LDC96L14 Sittichai Jiampojamarn, Grzegorz Kondrak, and Tarek Sherif 2007 Applying many -to- many alignments and Hidden Markov Models to letter- to- phoneme conversion In NAACL-HLT ... Synthesis Michael Collins and Terry Koo 2005 Discriminative reranking for natural language parsing Computational Linguistics, 31(1):25–70 Lara Tagliapietra and Patrizia Tabossi 2005 Lexical stress ... with a set of automatically-created negative examples Each negative has an incorrect, but plausible, stress pattern, u We adopt a Support Vector Machine (SVM) solution to these ranking constraints...

Ngày tải lên: 23/03/2014, 16:21

9 328 0
A Fun Way to Generate Ideas for Comparison Paragraphs.doc

A Fun Way to Generate Ideas for Comparison Paragraphs.doc

... students to this activity in pairs or small groups, in order to generate as many points and supporting sentences as possible Conclusion Usually, these paragraphs are so good that you may want to copy ... hospitals, etc Fold the pieces of paper and put them into a hat Go to each group, and ask one member to take two pieces These are the nouns that must be compared To help students form their topic ... the board: " and are similar in many ways." Tell the students to simply fill in the blanks with the two nouns they randomly selected Depending on the size of the class, I usually ask students...

Ngày tải lên: 06/09/2013, 05:10

2 344 0
5 Ways to Create Value for a Facebook Like

5 Ways to Create Value for a Facebook Like

... Hausman Marketin g Letter Orig in al article Connect: Author ed by: Dr Angela Hausman Hey, I'm Dr An g ela Hausman I'm a marketin g professor at Howard Un iversity an d run a full service marketin ... ewsfeeds Make a ch aritable don ation for each Facebook Like It makes you look GOOD an d en courag es sh arin g For example, Pedig ree don ated a bowl of dog food to a pet sh elter for each Facebook ... ood corporate citizen sh ip, tradition al advertisin g , product placemen t th at reson ates with your targ et audien ce an d auth en tic social media marketin g strateg ies Provide valuable ten...

Ngày tải lên: 08/02/2014, 09:36

2 367 0
Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc

Tài liệu Báo cáo khoa học: "A Ranking-based Approach to Word Reordering for Statistical Machine Translation" doc

... integrated into a phrasebased decoder serving as additional distortion features We evaluated our approach on large-scale Japanese-English and English-Japanese machine translation tasks, and experimental ... rest 75% as test data (auto) We sample a small corpus (575 sentence pairs) and manual alignment (man-small) We denote the automatic alignment for these 575 sentences as (auto-small) From Table 3, ... are not available from the Japanese parser Additionally, Japanese function words are also included as features because they are important grammatical clues The detailed feature templates are shown...

Ngày tải lên: 19/02/2014, 19:20

9 616 0
Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx

Tài liệu Báo cáo khoa học: "A Feature Based Approach to Leveraging Context for Classifying Newsgroup Style Discussion Segments" pptx

... finite-state automaton that only has two states The automaton is set to initial state (q0) at the top of a message It makes a transition to state (q1) when it encounters a quoted span of text ... scheme that novel thread based features have a greater and more consistent impact on classification performance Data and Coding We make use of an available annotated corpus of discussion data where ... that have proven successful for email act classification in comparison with a feature based approach Our evaluation demonstrates for the three separate dimensions of a context oriented annotation...

Ngày tải lên: 20/02/2014, 12:20

4 519 0
A Practical Approach to Water Conservation for Commercial and Industrial Facilities pot

A Practical Approach to Water Conservation for Commercial and Industrial Facilities pot

... Sao Paolo New York Mumbai (Bombay) Los Angeles Calcutta Shanghai Dhaka Delhi Buenos Aires Jakarta Osaka Rio de Janeiro Karachi Japan Mexico Brazil USA India USA India China Bangladesh India Argentina ... Europe North America Central America North Africa Central and South Asia Middle East Southeast Asia Central Africa South America Southern Africa Oceanania Virtual water trade balances of thirteen ... Buenos Aires A Practical Approach to Water Conservation urbanisation and water stress in regions around mega-cities as a ratio of total water withdrawals divided by estimated total availability...

Ngày tải lên: 06/03/2014, 17:20

395 453 0
Báo cáo khoa học: "Transonics: A Practical Speech-to-Speech Translator for English-Farsi Medical Dialogues" docx

Báo cáo khoa học: "Transonics: A Practical Speech-to-Speech Translator for English-Farsi Medical Dialogues" docx

... found in Narayanan et al., op.cit Enabling Effective Communication The approach taken in the development of Transonics was what can be referred to as the total communication pathway We are not ... Testing and Evaluation In addition to our own laboratory tests, the system was evaluated by MITRE as part of the DARPA program There were two parts to the MITRE evaluations, a "live" part, designed ... Narayanan 2003 Ascii based transcription schemes for languages with the Arabic script: The case of Persian In Proc IEEE ASRU, St Thomas, U.S Virgin Islands S Narayanan, S Ananthakrishnan, R Belvin,...

Ngày tải lên: 08/03/2014, 04:22

4 327 0
Ohio Pond Management Handbook a guide to managing ponds for fishing and attracting wildlife potx

Ohio Pond Management Handbook a guide to managing ponds for fishing and attracting wildlife potx

... should have a 10- to 15-acre watershed, or approximately three to five acres of drainage area for each acre-foot of water storage If the drainage area is too large, large and expensive spillway structures ... more compact toward the end of the stem than at the base Chara Chara is a form of algae that grows attached to the bottom, often covering large areas of the bottom with a layer several inches ... Solutions circulators on the market are aspirators, paddle wheels, compressed air injectors, fountain aerators, and wind-powered aerators See Appendix C for a list of aerator manufacturers Fish...

Ngày tải lên: 08/03/2014, 14:20

55 635 0
Learning Core Audio: A Hands-On Guide to Audio Programming for Mac and iOS ppt

Learning Core Audio: A Hands-On Guide to Audio Programming for Mac and iOS ppt

... asbd.mFormatID = kAudioFormatLinearPCM; asbd.mFormatFlags = kAudioFormatFlagIsBigEndian | kAudioFormatFlagIsSignedInteger | kAudioFormatFlagIsPacked; asbd.mBitsPerChannel = 16; asbd.mChannelsPerFrame ... that the amount of data needed to compress any particular part of the data changes Core Audio supports variable frame rate formats:The amount of data for any given frame may vary, but the packets ... Walker, Nick Thompson, Matthew Mora, Brad Ford, Murray Jason, and Edward Agabeg:Thanks for sharing with me your passion and knowledge of audio Special thanks to David Avila, Daniel Kaufman, Andre...

Ngày tải lên: 15/03/2014, 16:20

329 2,5K 4
Evolving to a New Dominant Logic for Marketing pdf

Evolving to a New Dominant Logic for Marketing pdf

... Mix to Relationship Marketing: Towards a Paradigm Shift in Marketing,” AsiaAustralia Marketing Journal, (August), 9–29 ——— (2000), Service Management and Marketing: A Customer Relationship Management ... Richard W., Roland T Rust, and Sanjeev Varki (1998), “Real-Time Marketing,” Marketing Management, (Fall), 28–37 Parasuraman, A. , Valarie A Zeithaml, and Leonard L Berry (1988), “SERVQUAL: A Multiple-Item ... the marketplace has a competitor: the potential customer (individual or organization) (Lusch, Brown, and Brunswick 1992; Prahalad and Ramaswamy 2000) The potential customer has a choice: engage...

Ngày tải lên: 15/03/2014, 22:20

17 660 0
COMPASS/ESL ® Sample Test Questions— A Guide for Students and Parents Writing Skills pptx

COMPASS/ESL ® Sample Test Questions— A Guide for Students and Parents Writing Skills pptx

... the Caspian Sea in the mid-1980s into U.S waterways aboard a transatlantic ship The zebra mussel probably steamed from the Caspian Sea aboard a transatlantic ship sometime in the mid-1980s into ... moneyed nations is today one of Africa’s most unflappable and loaded nations is today one of Africa’s most imperturbable and wealth-enhanced nations Item A B C D E After World War II, Senghor has entered ... Test Sample Items Item A B C D E is today one of Africa’s most stable and affluent nations is today one of Africa’s most rock steady and rich nations is today one of Africa’s most stubborn and...

Ngày tải lên: 19/03/2014, 08:20

28 742 0
A Guide to Guerrilla Marketing for Consultants: Tactics for Winning Profitable Clients potx

A Guide to Guerrilla Marketing for Consultants: Tactics for Winning Profitable Clients potx

... it all The book is available at Amazon and bookstores everywhere About the Authors JAY CONRAD LEVINSON is the chairman of Guerrilla Marketing International, a consulting firm serving large and ... consultants run their practices with no marketing plan at all, which is a sure-fire way back to a corporate job or to the unemployment line You can find dozens of approaches for creating a marketing ... A Guide to Guerrilla Marketing for Consultants By Jay Conrad Levinson and Michael W McLaughlin A Guide to Guerrilla Marketing for Consultants www.GuerrillaConsulting.com “When you try to be all...

Ngày tải lên: 23/03/2014, 03:20

24 364 0
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf

... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... using the forward primer AAATAAGTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start codon in bold) and the reverse primer CTTC ATCTGCAGTTAGTCTACTTCTTCCAT (PstI site underlined; stop codon ... kinase-5 (ERK5) mitogen-activated protein (MAP) kinase [18] GR assays indicated that human Hsp9 0a and Hsp90b, as well as the native yeast Hsp90s, were all capable of activating GR in these strains...

Ngày tải lên: 23/03/2014, 07:20

11 427 0
Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

Management in India: Grow from an Accidental to a Successful Manager in the IT & Knowledge IndustryA real-world, practical book for a professional in his journey to becoming a successful manager in IndiaRahul Goyalprofessional expertise distilled doc

... Coordinator Vishal Bodwani Proofreader Aaron Nash Kishore Shenoi Pankaj Ghanshani Indexer Tejal Daruwale Acquisition Editors Amey Kanse Kartikey Pandey Lead Technical Editor Kartikey Pandey Technical ... Thanks to the editors Amey Kanse, Kartikey Pandey, Ankita Shashi, and the project co-ordinators, Zainab Bagasrawala and Vishal Bodhwani for working with me on this book About the Reviewers Rajiv ... Impact tomorrow" Can business impact wait until tomorrow? So, what is a manager really supposed to manage? What we mean by management? [8] Chapter The classical definition of management, as also...

Ngày tải lên: 23/03/2014, 13:20

328 4,5K 0
Báo cáo khoa học: "A Two-Stage Approach to Retrieving Answers for How-To Questions" pot

Báo cáo khoa học: "A Two-Stage Approach to Retrieving Answers for How-To Questions" pot

... [Accessed 21 Oct 2005] Witten, Ian and Eibe Frank 2000 Data Mining: Practical Machine Learning Tools with Java Implementations, Morgan Kaufmann, San Mateo, CA Xu, Jinxi, Ana Licuanan, and Ralph ... resources to find news addressing specific topics They present a method for automatically generating “discriminant terms” (Stricker et al., 2000) for each topic that are then used as features to train ... system is a question rather than a few key words; b) a QA system aims to extract answers to a question rather than retrieving relevant documents only Most QA systems adopt a two-stage architecture...

Ngày tải lên: 24/03/2014, 03:20

8 280 0
A Guide to Spray Technology for Food Processing pptx

A Guide to Spray Technology for Food Processing pptx

... modular spray manifolds and custom solutions for more challenging applications A •  utoJet® spray controllers and automated systems that increase operational efficiency, decrease A manual operation ... to spray adhesives to secure labels on plastic, metal and glass packages PulsaJet automatic nozzle More Packaging Resources Can coating nozzle significantly saves coating material used per can ... control 1/4JAU Air Atomizing Nozzle Topic Literature Number VMAU Automatic Spray Nozzles 558 ® Automatic Nozzles PulsaJet 603 Air Atomizing Spray Manifolds 607 A  utoJet Model 1550 Modular Spray System...

Ngày tải lên: 24/03/2014, 04:20

12 416 0
For People with Cancer: A need-to-know guide for those who have been diagnosed with cancer doc

For People with Cancer: A need-to-know guide for those who have been diagnosed with cancer doc

... backache, sometimes upset stomach, abdominal pain, and diarrhea May take up to months to become ill • Gastrointestinal symptoms may appear within a few hours to to days, and disease may appear ... products, and gravy Symptoms and Potential Impact • Fever, headache, and muscle pain followed by diarrhea (sometimes bloody), abdominal pain, and nausea Symptoms appear to days after eating and may last ... prevalent in children Symptoms and Potential Impact • Stomach pain, diarrhea (can be bloody), nausea, chills, fever, and/or headache usually appear to 72 hours after eating; may last to days...

Ngày tải lên: 29/03/2014, 01:20

26 511 0
A Plain Letter To The Lord Chancellor On The Infant Custody Bill By Caroline Norton doc

A Plain Letter To The Lord Chancellor On The Infant Custody Bill By Caroline Norton doc

... this argument applied only to the legal appeal of a separated mother, when, if it has any force, it equally applies to all legal appeals; to every case that can be brought before a legal tribunal? ... of Infant Custody A Plain Letter to the Lord Chancellor on the Infant Custody Bill Again, Lord Brougham argued that, as adultery was by the law of God as great a crime in man as in woman, and reprobated ... communication, demanded as a preliminary to any arrangement, a written retractation of the various charges which had been made against his niece; and so far was Mr Norton at that time from adopting...

Ngày tải lên: 30/03/2014, 13:20

76 316 0
w