Ngày tải lên: 12/08/2014, 23:20
... plastic tissue culture dish The tissue was drained in a sieve and scraped into a beaker containing 20 ml of complete medium, 100 µg of collagenase A and µg of DNase A, mixed thoroughly and incubated ... expresses PAD and has a similar phenotype to that of cells abundant in the joint Second, it was detected as a synovial antigen that co-localised with staining for citrullinated proteins The staining ... protein, 46% of a larger panel of sera from patients with RA reacted with citrullinated α-enolase by immunoblotting This suggests that citrullinated α-enolase is at least as immunodominant as citrullinated...
Ngày tải lên: 09/08/2014, 07:20
DETERMINATION OF THE APPROPRIATE CONTENT OF CALCIUM NITRITE AS A CORROSION INHIBITOR IN REINFORCED CONCRETE docx
... extract containing (CN and 6,0 kg Cl-) Research results Effectiveness of corrosion inhibition in extract of cement water containing Cl-: • In H0 extract, steel is maintained in passive state and ... very fast under the effect of chloride ion in marine environment Cua Cam port The strongly agressivity rate of chloride ion is the main reason causing corrosion, especially in the tropical climate ... • The extract containing Cl-: corrosion rate is continuously increased with the time and with Clratios • At [Cl-]/[NO2-] 2,2; corrosion rate was very small Research results Case of reinforced...
Ngày tải lên: 13/08/2014, 22:21
Báo cáo khoa học: Benzo[a]pyrene impairs b-adrenergic stimulation of adipose tissue lipolysis and causes weight gain in mice A novel molecular mechanism of toxicity for a common food pollutant doc
... dysfunction leading to the accumulation of fat mass remains to be determined Available epidemiological data addressing the implication of PAH, in general, as a causal factor in the pathogeny of metabolic ... significant increase in food intake, caused by the lack of a satiety signalling, whereas no change in food intake was detected in the B [a] P-treated animals In addition, the absolute values of leptin ... levels of organochlorines released from adipose tissue during weight loss [7–9] The amount of pollutant released was positively associated with a lower relative metabolic rate as well as decreased...
Ngày tải lên: 30/03/2014, 11:20
báo cáo khoa học: "A Study to investigate the role of p27 and Cyclin E immunoexpression as a prognostic factor in early breast carcinoma" pptx
... spread and vascular invasion with distant metastases free survival (MFS) in all invasive carcinomas and the subgroup of IDC in an univariate analysis However, there was no significant association ... racial differences in breast carcinoma When disease stage and age at diagnosis were adjusted for, it was shown that African American (AA) women have increased odds of having features associated ... carcinomas [9] But the labelling index of cyclin D1 correlated with the pathological stage of the disease in invasive lobular carcinomas but not in invasive ductal carcinomas Another study evaluated...
Ngày tải lên: 09/08/2014, 01:24
Báo cáo y học: " Histology of adipose tissue inflammation in Dercum’s disease, obesity and normal weight controls: a case control study" doc
... image of fat tissue from the knee with an infiltrate of inflammatory cells Haematoxylin-eosin staining The infiltrate is displayed at a higher magnification in Figure The photo was taken with a ... autoimmune disease Case reports have shown that markers for autoimmune disease, such as rheumatoid factor (RF), antinuclear antibodies (ANA), anticardiolipin antibodies (ACA), perinuclear anti-neutrophil ... High-power image of Figure Adipose tissue from the knee Haematoxylin-eosin staining One infiltrate of this size and only a few additional inflammatory cells gave a score of I Two infiltrates of this...
Ngày tải lên: 11/08/2014, 03:20
Histology of adipose tissue inflammation in Dercum’s disease, obesity and normal weight controls: a case control study pdf
... image of fat tissue from the knee with an infiltrate of inflammatory cells Haematoxylin-eosin staining The infiltrate is displayed at a higher magnification in Figure The photo was taken with a ... autoimmune disease Case reports have shown that markers for autoimmune disease, such as rheumatoid factor (RF), antinuclear antibodies (ANA), anticardiolipin antibodies (ACA), perinuclear anti-neutrophil ... High-power image of Figure Adipose tissue from the knee Haematoxylin-eosin staining One infiltrate of this size and only a few additional inflammatory cells gave a score of I Two infiltrates of this...
Ngày tải lên: 11/08/2014, 06:23
Báo cáo y học: "Impaired expression of mitochondrial and adipogenic genes in adipose tissue from a patient with acquired partial lipodystrophy (Barraquer-Simons syndrome): a case report" pot
... environment in adipose tissue as causative of lipoatrophy in APL syndrome However, a wider analysis of markers of inflammation covering the distinct manifestations of the inflammatory process ... data from the physical examination of the patient and PD was a major contributor in writing the manuscript RRG, EG and II performed the analysis and interpretation of data in relation to renal ... presentation A biopsy sample of subcutaneous adipose tissue was taken from the arm Control values of gene expression in adipose tissue were obtained from the analysis of biopsies of subcutaneous adipose...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo khoa học: "omputer tomographic investigation of subcutaneous adipose tissue as an indicator of body composition" pot
... volume of adipose tissue to total volume expressed as a percentage (fat-index) was calculated, taken as an indicator of general adiposity and used in the statistical analyses It should be noted that ... coefficient, indicating the association between fat-index and the combined skin plus SAT thickness at each measure point was calculated The sum and range of these values for the three scans at each measure ... quantitative aspects of CT imaging modality are being increasingly recognized in many areas including in the study of obesity [20,21] Figures and illustrate the extent of the data They display...
Ngày tải lên: 12/08/2014, 18:22
Stability and in vivo evaluation of pullulan acetate as a drug nanocarrier
... and the acute toxicity of PANs was evaluated in mice Morever, EPI was loaded into PANs and its pharmacokinetics was also assessed in rats to compare to the free drug Methods Materials Pullulan ... (Mw = 200,000) was purchased from Hayashibara (Tokyo, Japan) Epirubicin·HCl (EPI·HCl) was purchased from Hisun Pharmaceutical Co (Zhejiang, China) Poly (vinyl alcohol) (PVA) with an average molecular weight ... Plasma drug concentration of EPI and PA/EPI after i.v injection in rats at a single equivalent dose of 10 mg/kg Table 5. Pharmacokinetic parameters of EPI and PA/EPI i.v injected in rats at...
Ngày tải lên: 23/04/2013, 21:38
Evaluation of Dredged Sediment as a Silt and Clay Source for Artificial Tidal Flats
... observed variation in the macrobenthos population in the artificial tidal flats and the natural tidal flat The abundance of macrobenthos in the artificial tidal flats increased after May 28 and finally ... products in artificial tidal flats in Japan, a growth test of R philippinarum was also carried out in DS mixtures MATERIALS AND METHODS Artificial tidal flats in real seashore Five artificial tidal ... mixtures, a control tidal flat was made using natural tidal flat sea sand with 25% silt and clay content obtained from Hiroshima bay, Japan Prior to use, the natural tidal flat sea sand was dried We inoculated...
Ngày tải lên: 05/09/2013, 09:38
Assessment of pretreatments and enzymatic hydrolysis of wheat straw as a sugar source for bioprocess industry
... groups are removed forming acetic acid Organic solvent such as acetone can be used to precipitate and separate the fractionated biomass The pretreatment has an advantage of operating at low temperature ... Wax consists of primarily long chain fatty acids and fatty alcohols, sterols and alkanes Natural waxes have a wide range of industrial uses in cosmetics, polishes and coatings, pharmaceuticals, ... xylan-degrading enzymes (Figure 4) And such a whole suite of accessory enzymes is required for efficient xylan hydrolysis such as α-arabinofuranosidases and α-Larabinases that release arabinan [31],...
Ngày tải lên: 05/09/2013, 15:28
A contrastive analysis of encouraging as a speech act in english and vietnamese
... STATEMENT OF THE PROBLEM teachers and learners of English as well as other potential interactants In the past, a series of studies regarding different speech acts of international communication ... relationship between semantics and pragmatics and covers some of the basic techniques and key concepts involved in studying and analyzing pragmatic meaning narrowest interpretation of pragmatics ... communication in a foreign language and partly in Communicative encouraging in English and Vietnamese as a speech act Language Teaching 1.3 SCOPE OF THE STUDY 1.2 AIMS AND OBJECTIVES 1.2.1 Aims of The...
Ngày tải lên: 26/11/2013, 13:31
Tài liệu Báo cáo khoa học: Role of transcription factor activator protein 1 (AP1) in epidermal growth factor-mediated protection against apoptosis induced by a DNA-damaging agent doc
... the MAP kinase cascade [49] Our study showed that EGF caused a substantial increase in AP1 DNA binding In addition, this increase was prevented by MAP kinase kinase inhibitor PD98059 (Fig 5A) The ... cDNA that had been labeled with [32P]dCTP by use of a Rediprime II DNA Labeling System (GE Healthcare) Caspase activity assay Caspase activity was examined according to the instruction manual of ... EGF and ADR as described in (A) , harvested at the indicated times after the addition of ADR, and used for immunoblot analysis of pro-caspase and caspase (C) Cells were treated with EGF and ADR as...
Ngày tải lên: 19/02/2014, 06:20
Báo cáo khoa học: Biological role of bacterial inclusion bodies: a model for amyloid aggregation potx
... 35 Nahalka J, Dib I & Nidetzky B (2008) Encapsulation of Trigonopsis variabilis D-amino acid oxidase and fast comparison of the operational stabilities of free and immobilized preparations of ... folding status of cellular proteins [23], soluble but also insoluble In agreement with this concept, the main Escherichia coli chaperone DnaK (a holding agent and a foldase and disaggregase), is almost ... protein–protein interactions in the context of amyloid and prion diseases Dynamics of IB formation and biological activity Intracellular electrodense proteinaceous granules had been observed in...
Ngày tải lên: 06/03/2014, 00:20
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx
... are in a thin dating market) to find partners To what extent is the partnership rate of heterosexual women of a certain age a reasonable measure of the lack of availability of partners for single ... through almost all of the traditional ways has fallen Family of origin and primary and secondary school (the “traditional” institutions based around place of origin) had already declined in importance ... the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and Hispanics are the two groups that contribute most to racial and ethnic...
Ngày tải lên: 15/03/2014, 21:20
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... provide an attractive explanation for many of the features of aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based ... idea that mitochondrial and lysosomal injury and dysfunction play a central role in the aging of postmitotic cells, as well as in aging of the whole organism, considering the particular importance ... importance of such cells (including neurons and cardiac myocytes) for life maintenance Mitochondria are the main source of ROS formation, as well as the main target for free radical attack The accumulation...
Ngày tải lên: 17/03/2014, 23:20
adoption and impacts of zero tillage as a resource conserving technology ppt
Ngày tải lên: 18/03/2014, 11:22
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... nonspecific deacetylase inhibitor trichostatin A (TSA) resulted in the appearance of a significant amount of acetylated tubulin (Fig 1C, and h; Fig 1D), indicating that both acetylase and deacetylase were...
Ngày tải lên: 23/03/2014, 05:22
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon Earhart References Argue, J (2000) Parkinson’s disease and the art of moving Oakland, CA: New Harbinger Beauchet, ... that the waltz was just as good as traditional aerobic exercise and that people were happier, which was demonstrated by increases in a measure of quality of life, and greater likeliness to comply ... Center Morale Scale (Lawton 1975) Balance was evaluated using the Functional Reach (Duncan et al 1990) and One Leg Stance Test (Vellas et al 1997) Walking velocity was assessed by tracking a reflective...
Ngày tải lên: 28/03/2014, 20:20