rhob is a crucial target of farnesyltransferase inhibitors

... 5¢-TTCAATGTGTCTGATTGGGCAGCTCTACTAGA AAAGGCTG-3¢; for E318 to I, 5¢-CAATGTGTCTGA TATAGCAGCTCTACTAGAAAAG-3¢; for E318 to R, 5¢-CAATGTGTCTGATCGAGCAGCTCTACTAGAAA AG-3¢; for E318 to Y, 5¢-CAATGTGTCTGATTATGCA ... study Lancet 353, 351–353 20 Matsubara, Y., Murata, M., Maruyama, T., Handa, M., Yamagata, N., Watanabe, G., Saruta, T & Ikeda, Y (2000) Association between diabetic retinopathy and genetic variations ... addition of ABTS reagent as above For assays measuring the binding of VWFA domain to collagen in the presence of increasing cation concentrations, NaCl/Tris was cleared of residual cations by the addition...

Ngày tải lên: 08/03/2014, 22:20

... industry Within the American society, there are many races such as white, black or African-American, American Indian or Alaska native, Asian, native Hawaiian, other Pacific Islander and ethnic groups ... particular and with our American friends in general II.2.2 Racial discrimination Racial discrimination is as old as American history since the first black African slaves came to America over three ... leading in their big mansions… Smoking jackets and cravats, spats and canes, elegant garden parties and martinis… This was a world of so elegantly distant from ours, it was like a voyage to another...

Ngày tải lên: 07/11/2012, 15:01

... C, Cardinale F, Cazzola G, Consolini R, De Mattia D, Dell’Erba G et al (2002) Clinical, immunological, and molecular analysis in a large cohort of patients with X-linked agammaglobulinemia: an ... kinases and disease A Hussain et al disease, in which TFKs are showing increasing importance, both as an underlying cause, but recently also as potential targets for new drugs The main emphasis ... a rare variant, a nonpathogenic mutation predicted to affect the BTK SH3 domain by generating an A2 30V amino acid substitution, was reported [23] Structural analysis shows that this residue is...

Ngày tải lên: 14/02/2014, 18:20

... 5' tatcagcaaattgcaaggattaga 3' and 5' tcaccactttgtattgtttttcct 3'; cer465605: 5' tgggagttccaatgtttaaag 3' and 5' attgatggaatggaacagaga 3'; cer452156 5' acacgaccaagaagtcaaata 3' and 5' acaattcttgtcgggcagat ... Plant Biology 2007, 7:20 cer453259: 5' ggtccaaacaaaaacaaattcc 3' and 5' cgaacaatcaagccacctct 3'; SNP82: 5' tggaaagccattgatggaagg 3' (Col) or 5' tggaaagccattgatggaagc 3' (Ler), and 5' ttccgaagaccagaataacca ... acaattcttgtcgggcagat 3'; cer474010 5' cgaccctcgagaaagaacaa 3' and 5' gttatactgcgcctggaacc 3'; cer453463: 5' aataaaggcccatcttgtgtgt 3' and 5' actggagcgtcgtcattagttt 3'; Page 10 of 13 (page number not for citation...

Ngày tải lên: 12/08/2014, 05:20

... 5¢-AGACAGCCGTTTTACACGCAG-3¢; P2 antisense, 5¢-CACCGAGAAATCGAAATCACC-3¢; P3 sense, 5¢-TAGGAAGGTTGTATCGCGGAGG-3¢; and P3 antisense, 5¢-CAAGGAAGGAGGACTGGGCTC-3¢ [28] The locations of P1, P2 and P3 at the p16 ... isothiocyanate-conjugated goat anti-(rabbit serum) as secondary antibody, incubated with rat anti-3MeK9H3 serum and stained with TRITCconjugated goat anti-(rat serum) as secondary antibody, and ... chromatin solution was precleared with 50 lL of protein A agarose beads (Upstate Biotechnology, Santa Cruz, CA, USA) The soluble fraction was collected, and lg of antibodies against acetyl-histone...

Ngày tải lên: 07/03/2014, 02:20

... P-Kirchhoff problem began to attract the attention of several researchers mainly after the work of Lions [1], where a functional analysis approach was proposed to attack it The reader may consult ... constant a and a bounded neighborhood D of in X2 such that J|∂D ≤ a and, (ii) there is a constant b >a such that J |X ≥ β, then J possesses a critical value c ≥ b, moreover, c can be characterized ... functional J : D ® R is Fréchet differentiable on D If x0 Î D and the Fréchet derivative J’ (x0) = 0, then we call that x0 is a critical point of the functional J and c = J(x0) is a critical value of...

Ngày tải lên: 20/06/2014, 22:20

... Bioinformatics (RCSB) database (114, Adapted from Strickland et al., 2011) Gene Name ALDH 4A1 ALDH 7A1 Chromosome location 1p36.13 5q31 ALDH 1A1 ALDH 1A2 ALDH 1A3 ALDH1B1 ALDH2 ALDH1L1 ALDH1L2 ALDH 9A1 ALDH 5A1 ... of this compound as a potential drug (41) Cyanamide is another ALDH inhibitor; it is administered as a pro-drug and is used for the treatment of alcohol addiction in Europe, Canada and Japan (42) ... to ALDH1B1, the human ALDH1 family also contains the ALDH 1A1 , ALDH 1A2 and ALDH 1A3 subfamilies These ALDH 1A isozymes are the primary isoenzymes that synthesize Retinoic Acid (RA) from retinal and...

Ngày tải lên: 24/08/2014, 09:58

... relaxation times are unsatisfactory so far, because radiation induced necrosis [58], vital tumor tissue and cerebral metastases are nearly undistinguishable.[51] Additionally, preclinical data suggest ... use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain tumors By the fact that the rare earth metals trapped inside of the carbon cage are ... evaluation of Gd@C60[C(COOH)2]10 as a MRI contrast agent J Am Chem Soc 2003; 125: 5471-8 Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents...

Ngày tải lên: 26/10/2012, 09:07

... N-Pro 208 aa 34 aa CT - ex Stop 114 aa Xho1 365 aa 24 aa 208 aa N-Pro N Pro II 24 aa Protease domain BamH H1 Start I 114 aa Pre A S Dutta et al Protease domain CT - ex 34 aa III 208 aa N-Pro NP ... The Authors Journal compilation ª 2011 FEBS S Dutta et al cysteine proteases [Erv -A, -B and –C (isolated from the latex of Ervatamia coronaria in our laboratory) and papain from Carica papaya (Merck, ... protease from the latex of Ervatamia coronaria Biosci Biotechnol Biochem 62, 1947–1955 15 GuhaThakurta P, Biswas S, Chakrabarti C, Sundd M, Jagannadham MV & Dattagupta JK (2004) Structural basis of...

Ngày tải lên: 14/02/2014, 14:20

... Program Administrators (STAPPA) and the Association of Local Air Pollution Control Of cials (ALAPCO) are the two national associations of air quality of cials in the states, territories and major ... Fine Particulate Matter Under the Clean Air Act: A Menu of Options STAPPA State and Territorial Air Pollution Program Administrators ALAPCO Association of Local Air Pollution Control Of cials March ... About STAPPA and ALAPCO v Introduction The State and Territorial Air Pollution Program Administrators (STAPPA) and the Association of Local Air Pollution Control Of cials (ALAPCO) have prepared...

Ngày tải lên: 17/02/2014, 11:20

... Hagiwara, Y., Hagiwara, H., Ueyama, H & Goldstein, A. L (1994) Isolation of a vitamin E analog from a green barley leaf extract that stimulates release of prolactin and growth hormone from rat anterior ... grade commercially available Data were expressed as the mean ± standard deviation of at least three independent experiments Statistical significance was assessed by multiple-comparison test (Fisher’s ... succinate-induced apoptosis in Jurkat T cells involves caspase-3 activation, and both lysosomal and mitochondrial destabilization FEBS Lett 445, 295–300 12 Yamamoto, S., Tamai, H., Ishisaka, R., Kanno,...

Ngày tải lên: 22/02/2014, 04:20

... trash bin manners matter 17 Foul Language Almost all of us are guilty of the occasional expletive Asking all golfers to cease swearing, while an admirable concept, simply isn’t practical What is ... shop A few minutes later, an assistant pro drove up in a cart and informed Jack of the situation Jack had to pick up his ball and accompany the assistant back to the clubhouse, where he was then ... stop and appreciate the beauty of the places that, as golfers, we get to enjoy I was having a particularly bad day on a course in Pagosa Springs, Colorado After yet another lousy shot, my cart mate...

Ngày tải lên: 22/02/2014, 08:20

... Annals of Mathematics, 158 (2003), 679–710 Approximating a bandlimited function using very coarsely quantized data: A family of stable sigma-delta modulators of arbitrary order By Ingrid Daubechies ... significantly) In practice, it is customary to sample audio signals at a rate that is about 10 or 20% higher than the Nyquist rate; for high quality audio, a traditional sampling rate is 44,000 ... n∈Z At this stage, each of these samples is still a real number The transition to a discrete representation for each sample is called quantization nπ The simplest way to “quantize” the samples...

Ngày tải lên: 05/03/2014, 23:20

... savings were achieved by eliminating most of the Crocker management structure Alternatively, acquisition of a relative small bank also has potential advantages, such as an easier integration of ... mergers, and rose to 34% after the mergers, for a statistically significant increase of 10 percentage points That is, the assetweighted average of all large banks that had consistent data over the same ... EFF1 and EFF2 The estimated marginal effect of EFF1 is 480W2 - 63oWl, which is almost always negative since WI is generally larger than W2 Evaluated at the average value of W2 = 28, this partial...

Ngày tải lên: 06/03/2014, 08:21

... expression and characterization of class III chitinases from rice (Oryza sativa L.) Enzyme Microbial Technol 30, 697–702 13 Nagasaki H, Yamamoto K, Shomura A, Koga-Ban Y, Takasuga A, Yano M, Minobe ... clarify some features of the evolution of this family of chitinases Experimental procedures Materials and strains The cDNA clone encoding a putative rice class III chitinase (DNA Data Bank of ... Xanthomonas oryzae pv oryzae, the causal agent of bacterial leaf blight, a serious disease in rice [17–19] The recent demonstration that xylanases secreted by rice pathogens are important factors of...

Ngày tải lên: 07/03/2014, 17:20

... times faster than that of the beta chains and that the oxidation of the beta chains was not influenced by pH The biphasic reaction was shown to consist of a rapid initial reaction followed by a slower ... oxidation rate A comparison with the auto-oxidation rate (data from Fig 3) revealed that in the presence of EDTA, the increase in the rate of oxidation of Hb A0 produced by the LPSs of rough and ... initial fast phase of the reaction, but decreased the rate of the slow phase of oxidation in the presence of EDTA A comparison of rough and smooth LPSs of E coli and S minnesota in the presence of...

Ngày tải lên: 08/03/2014, 10:20

... macrocypins are stronger inhibitors of papain, as a result of higher rate constants of association, but weaker inhibitors of cathepsin L, mainly because of increased rate constants of dissociation ... similar basic biochemical characteristics They have similar molecular masses of 19 and 16.8 kDa and similar isoelectric points of around 4.8 They both exhibit stability against high temperature and ... (Z)-Phe-Arg-7-amido-4-methylcoumarin (AMC) as substrate, and for legumain with Z-Ala-Ala-Asn-AMC as the substrate, while stopped assays were performed for cathepsins K, S and B using Z-Phe-Arg-AMC as...

Ngày tải lên: 16/03/2014, 02:20

... [9] at the linker region was constructed by amplifying the whole plasmid pEU-scFvLH by inverse PCR with the primers s2: 5¢-CAAAAAATTGAATGGCATG AACCGCCGAGCTCCAAC-3¢ and a2 : 5¢-AGCTTCAA AAATATCATTTAAACCCGACGGGCTGCTTTT-3¢ ... 5¢-CTACC AGATCTGCCATGCAGATCGTTGTTACCCAGG-3¢ and a1 : 5¢-GGCTAAGAGCTCACGGTCAGGCTCG-3¢ by using a LATaq PCR kit (50 lL) The sequences underlined are the BglII restriction site and initiation codon, and ... (5¢-ATTTAGGTGACACTATAG-3¢) and anti-primer (5¢-ATGGCGCCAGCTGCAGGCTA-3¢, anti-stop codon in bold), and transcribed in the same way as above Translation was carried out with the purified mRNA (75 lgÆmL)1)...

Ngày tải lên: 16/03/2014, 23:20