... displayed as side chains and located in domain III, domain V and the interface of domains G, III and V (B) Mutation sites in domain III that may affect the FA-binding pocket Mutation sites are ... helices AV and BV at the surface of domain V Gly621 and Gly617 are in the area of contact with the 1095 and 2473 regions of 23S RNA The two helices are facing the ribosome, and the four-stranded ... Helgstrand M, Mandava CS, Mulder FA, Liljas A, Sanyal S & Akke M (2007) The ribosomal stalk binds to translation factors IF2, EF-Tu, EF-G and RF3 via a conserved region of the L12 C-terminal domain...
... Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, ... Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria ... TLPs are indicated above the alignment: motifs A –C’ are indicated with straight lines and are labelled; b-strands are indicated with arrows and are labelled A H A single a- helix is indicated...
... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of ... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function andof the number of simulator ... Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with use of...
... subunits and a- BTX distinguished two major classes of nAChRs: a major population of a- BTX binding a7 * nAChRs which is mainly localized perisynaptically, anda less abundant population of a3 * nAChRs ... investigation and understanding of their structure- activity relationships, may start to provide a rational way to develop additional pharmacological tools for the elucidation of nAChR structureand ... interfaces within neuronal nAChR subunit combinations (compare Fig 2A C) So far, a- conotoxins selectively targeting mammalian a3 b2 (a- MII, a- GIC) a6 b2 (a- MII, a- PIA), a3 b4 (a- AuIB) and a7 (a- ImI)...
... measured at room temperature ROA data originating in artefacts from buer bands have been cut out in some places Fig The backscattered Raman and ROA spectra of recombinant human wild-type tau46 ... backscattered Raman and ROA spectra of recombinant wild-type human a- synuclein (top pair) together with those of the A3 0P (middle pair) and A5 3T (bottom pair) mutants at pH 7.2 All three ROA ... the acquisition of ROA data of suf®cient quality for reliable analysis A ROA spectrum of rather poor quality of an impure commercial sample of a- casein (composition unde®ned) was reported in an...
... were obtained for more than 99% of the 1H, 13C and 15N atoms of the protein backbone, and for more than 78% of the side chain atoms The main set of backbone u and w dihedral angles was calculated ... stretch of C-terminal acidic amino acids of translational release factor eRF1 is a primary binding site for eRF3 of fission yeast RNA 4, 958–972 Ebihara K & Nakamura Y (1999) C-terminal interaction of ... basis of the structural data, we have performed a mutational analysis of the C-domain and investigated the impact of the mutants on stop codon recognition Results Resonance assignment H, 13C and...
... 5¢-CGGAACCCCGCAGGTCGAGTTTCC-3¢ and 5¢-GA CGAGGTGCTCGGGGCTCTT-3¢; Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢ The mutation (codon underlined above) was confirmed by DNA ... 188–122) A large difference is centred on Met121 In particular, the mean B-factors of Met121 at ˚ ˚ the Aand B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms ... partial active enzyme intermediate, and kfast and kslow are A nity labelling of maize GST I (Eur J Biochem 271) 3505 the rate constants for the slow and fast phase of the reaction Analysis was...
... oleic acid [2] The complex was named HAMLET and was defined as a complex between partially unfolded a- lactalbumin and oleic acid Human a- lactalbumin is a globular 14.2 kDa milk protein (123 amino acids), ... side chains of asparagines 82, 84, 87 and 88 and lysine 79 [14] The a- helical domain contains three major ahelical (amino acids 5–11, 23–34 and 86–98) and two short 310-helical domains The smaller ... Hospital Foundation, Royal Physiographic Society, Anna-Lisa, Sven-Erik Lundgren Foundation, Knut and Alice Wallenberg Foundation, Inga-Britt and Arne Lundbergs Foundation and the John and Augusta...
... COQ1 -a COQ1-b dps1 -a dps1-b Description (5¢- to 3¢) CCGGATCCCATGTTTCAAAGGTCTGGC GCCCCCGGGTTACTTTCTTCTTGTTAGTA TAC CCGGATCCATGTTTCAAAGGTCTGGC CGAATTCTTACTTTCTTCTTGT CAGTGAATTCGAGCTCGGTACCC ATACATACTGAATCATCATCTCCTTC ... Okada K, Kamiya Y, Zhu X, Tanaka K, Nakagawa T, Kawamukai M & Matsuda H (1997) Analysis of the decaprenyl diphosphate synthase (dps) gene in fission yeast suggests a role of ubiquinone as an antioxidant ... Arabidopsis thaliana Plant Mol Biol 55, 567–577 14 Saiki R, Nagata A, Kainou T, Matsuda H & Kawamukai M (2005) Characterization of solanesyl and decaprenyl diphosphate synthases in mice and humans FEBS...
... end ofa signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ were ... construction of the poneratoxin gene [11] Two oligonucleotides: forward 5¢-GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-3¢, were used...
... years at the time of analysis The patient expressed elevated titers of anti-52 kDa Ro(SS -A) and anti-52 kDa La(SS-B) antibodies, had marked hypergammaglobulinemia, and was rheumatoid factor (RF) ... obtained from the peripheral blood of the same patient This patient manifested increased titers of autoantibodies (anti-Ro and anti-La), hypergammaglobulinemia and enlargement of the parotid glands, ... The analysis of the R/S ratio and the mutational ‘hot spots’ of productive VL chain rearrangements of peripheral blood and parotid gland B cells revealed no major abnormalities when compared...
... chloroplast ultrastructure, and leaf characteristics of high- and low-light plants andof sun and shade leaves Photosynth Res 2, 115-141 light E.M (1986) Correlation of activity and amount of ribulose ... ultrastructure was analyzed from the electron micrographs as described by Aro et aL, (1986) and Vapaavuori (1986) On an average, typi- cal chloroplasts were analyzed sample of the replicate plots ... correla- N P and the ratio of the length of appressed to nonappressed thylakoid membranes (Fig 2A) and between the ratio of the length of appressed to non-appressed thylakoid membranes and photon...
... leadership and coordination, participated in data analysis and interpretation, drafted the final manuscript, and approved the final submitted manuscript LD conducted data analysis and made major ... JAMA-Journal of the American Medical Association 41 Research Policy 39 Medical Journal of Australia 32 International Journal of Technology Assessment in Health Care 32 Journal of the American ... Small [60], we argue that both normative and constructivist interpretations of citation patterns are valid Author co-citation analysis In ACA, cited and co-cited authors are the unit of analysis...
... leadership and coordination, participated in data analysis and interpretation, drafted the final manuscript, and approved the final submitted manuscript LD conducted data analysis and made major ... JAMA-Journal of the American Medical Association 41 Research Policy 39 Medical Journal of Australia 32 International Journal of Technology Assessment in Health Care 32 Journal of the American ... Small [60], we argue that both normative and constructivist interpretations of citation patterns are valid Author co-citation analysis In ACA, cited and co-cited authors are the unit of analysis...
... architecture/spatial organization of the cell, and the effect of these spatial configurations on the manifestation of biochemical laws, can be viewed as similar to a computer’s ISA [3] The software aspect of ... BFAT may also be realized within the wetware circuitry of transduction signaling pathways representative ofa form of cell firmware Page 17 of 29 D’Onofrio and An Theoretical Biology and Medical ... access of biological information via the DNA transcription machinery One of the limitations of the Central Dogma (and, for that matter, the abstract description ofa digital computer as a Von Neumann...
... words and parataxis and low grammatical intricacy 3.4 Clause and Clause Complexes Analysis The analysis of the text into clause and clause complexes and their logico-semantic relations can be ... mở Material: trải qua Relational Relational: xứng đáng Relational Material: hướng Material: trải qua Relational Material: gắn bó Verbal: chào mừng Material: trân trọng Relational: Relational: ... Mental: biết ơn Material: đổ Relational: có Material: chắn Material: ngăn Relational: có Material: tiếp nối Material chiến đấu Material: hiến dâng Material: bảo vệ Relational: Relational: Mental:...