replication of hepatitis c in tissue culture

... Effect of UVC light irradiation on HCVcc infectivity To examine the effect of continuous UVC light on HCVcc infectivity, 200-μl aliquots of HCVcc stock (2.5 × 104 FFU/ml) were placed in 48-well ... http://www.virologyj.com/content/7/1/40 Page of 12 B A HCVcc in culture medium HCVcc in culture medium RT 37° C Log 10 FFU/ml Log 10 FFU/ml 4 3 1 0 16 24 32 40 48 10 12 14 16 Days Hours D C HCVcc in culture ... stability of HCVcc is inversely correlated with temperature Effect of heat treatment on HCVcc infectivity To evaluate the sensitivity of HCVcc to heat treatment, aliquots of HCVcc stock (2.5 ×...

Ngày tải lên: 12/08/2014, 04:21

... AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC GCGGCCGCAAA GGCTGCACGACACTCCGCCATGGCTAGACGCTTTC CGTCTAGCCATGGCGGAGTGTCGTGCAGCCTCCAGG CCCCTGATGGGGGCGTATTTCCACCATGAATCACTCCCC GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA ... TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA TAATACGACTCACTATAGGGGCACGCCCAAATCTC GCCAGCCCCCTGATGGGGGCGA ... GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGACACTCCACCATGAATTCT AGCCATGGTTT AAACCATGGCTAGAATTCATGGTGGAGTGTCGCCCCCATCAGGGGGCTGGC...

Ngày tải lên: 20/02/2014, 01:20

... be interesting to evaluate HCVcc infectivity few cell lines support infection technical difficulties of primary cell culture no secretion of particles independence of CD81 for entry no budding ... Electroporation in Huh7 cell lines HCVcc production Infection of Huh7 cell lines Expression analysis of viral protein or reporter protein Cellular clone of HCV Fig The HCVcc model Huh7 cell lines ... particles produced in insect cells using a recombinant baculovirus containing the cDNA of HCV structural proteins of genotype 1b or 1a [48] HCV-like particles were observed by electron microscopy...

Ngày tải lên: 16/03/2014, 05:20

... http://www.virologyj.com/content/4/1/79 A 63 TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTGCAGCCTCCAGGACCCCCCCTCCCGGGAGA TTCACGCAGAAAGCGTCTAGCCATGGCGTTAGTATGAGTGTCGTACAGCCTCCAGGACCCCCCCTCCCGGGAGA GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG ... GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG GCCATAGTGGTCTGCGGAACCGGTGAGTACACCGGAATTGCCAGGACGACCGGGTCCTTTCTTGGATCAACCCG CTCAATGCCTGGAGATTTGGGCGTGCCCCCGCGAGACTGCTAGCCGAGTAGTGTTGGGTCGCGAAAGGCCTT ... gccagcccccuguugggggcgacacuccaccauagaucacuccccugugaggaacuacugucuucacgcagaaag domain I g g domain II 100 150 cgucuagccauggcguuaguaugagugucgugcagccuccaggaccccccccucccgggagagccauaguggucu g u domain II a g u u c 200 gcggaaccggugaguacaccggaauuccaggcagaccgguccuuucuuggaucaacccgcucaaugccuggagauu...

Ngày tải lên: 18/06/2014, 18:20

... Patients were consecutively collected from the Hepatitis Clinic at Los Angeles County-USC Medical Center between January 1990 and December 1998 The inclusion criteria included: chronic HCV infection ... followed in the Hepatitis Clinic at USC-LAC Medical Center In these patients, 71.4% were minorities, including African American, Hispanic, and Asian patients, indicating that a high prevalence of HCV ... hepatitis clinic To verify the accuracy of clinical discriminant score in diagnosing cirrhosis, the clinical diagnosis was further assessed in 79 patients who had pathological diagnosis Compared...

Ngày tải lên: 08/08/2014, 18:20

... remains inconclusive [2] In our Chang et al Journal of Medical Case Reports 2011, 5:246 http://www.jmedicalcasereports.com/content/5/1/246 Page of Figure Clinical course of a renal transplant recipient ... Taiwan; Chang et al Journal of Medical Case Reports 2011, 5:246 http://www.jmedicalcasereports.com/content/5/1/246 Graduate Institute of Clinical Medical Sciences, Chang Gung University, College of ... therapy could achieve sustained eradication of HCV infection in renal transplant recipients with dual HBV and HCV infections Consent Written informed consent was obtained from the patient for publication...

Ngày tải lên: 10/08/2014, 23:21

... pre-mmu-miR-328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega) The Rluc:miR-328 binding site reporter constructs, in which Rluc is coupled ... by PCR using forward (5'-gcgcgcactagtgccagccccctgatgggggcgacac-3') and reverse (5'-gcgcgcactagtttacaatttggactttccgcccttc-3') oligonucleotides, and transferred to the XbaI/BamHI sites of pRL-CMV ... (5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3') binding sites into the PmeI site of psiCHECK (Promega) The integrity of the constructs was verified by restriction analysis and DNA sequencing...

Ngày tải lên: 11/08/2014, 07:21

... of care The predictive value of SNPs is best calculated from routine clinical practice, rather than the clinical trial scenario, since these are the conditions in which most patients are treated ... transcription factors gene, which includes promoter variants, intronic, codon changing, and 3’untranslated SNPs, any of which could be, or could contribute with others, to the functional effect of ... genotyping, SNP rs4803221 and HLA -C C 2C2 provides the best predictive value Clinical utility Therapy for HCV infection is currently undergoing a radical transformation with the advent of Direct Acting...

Ngày tải lên: 11/08/2014, 12:21

... piloting of a new intervention is a crucial first step before conducting pragmatic RCTs of psychological interventions in the field of addiction; that an infrastructure and culture for psychosocial ... the efficacy of EPC in reducing new cases of HCV remains inconclusive Notably, there were many significant changes on some of the secondary outcome measures from baseline values, indicating positive ... marginally effective at reducing HCV incidence and limited evidence evaluating the effectiveness of behavioural interventions in reducing its inci- Table 5: Changes in situational confidence, hepatitis...

Ngày tải lên: 11/08/2014, 18:20

... tools using CLC workbench software http:// www.clcbio.com Amino acid composition was calculated using MEGA version 4.1 The subject is very controversial as some of the investigators reported a correlation ... Predictors of the efficacy of interferon therapy in chronic hepatitis C virus infection Tokyo-Chiba Hepatitis Research Group 1997, 113:558-66 Kaufman RJ: The Double-stranded RNA-activated Protein ... polar amino acids in all samples Among polar amino acids positively charged amino acids were greater than negatively charged amino acid thus making it a basic stretch that might be involved in interacting...

Ngày tải lên: 11/08/2014, 21:21

... enhanced the infection rate in this country [23] This type of practice is still common in the countryside especially in KPK province which needs effective check for minimizing the spread of HCV infection ... important findings The first finding is incidence of HCV genotypes that confirms the 36 P value NS NS findings of another study from this country [23] The second important finding of the study ... advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar...

Ngày tải lên: 12/08/2014, 04:20

... Glucose intolerance in liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32(10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti ... participated in data collection and Statistical analysis GE Participated in drafting of the study design NS Participated in study coordination GP Participated in Data collection EO Contributed in ... being infected with HCV might suffer from insulin resistance resulting in more adverse effects of diabetes than those with HCV infection alone It was observed from this study that the occurrence...

Ngày tải lên: 12/08/2014, 04:21

... study of HCV infection and antiviral drug studies in more polarized, xenobiotically-competent cells Figure Robust HCVcc infection in 3-D Huh7 RWV cultures Robust HCVcc infection in 3-D Huh7 RWV cultures ... permissiveness of the cell for HCVcc infection [10,11], we sought to determine if Huh7 3-D cultures were permissive for HCVcc infection As such, 3-D Huh7 cultures were inoculated with HCVcc JFH-1 1, ... Hepatitis C Virus infection in phenotypically distinct Huh7 cell lines PLoS ONE 2009 in press Uprichard SL, Chung J, Chisari FV, Wakita T: Replication of a hepatitis C virus replicon clone in mouse cells...

Ngày tải lên: 12/08/2014, 04:21

... MC, Diepolder HM, Schirren CA, Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M, et al.: Association of hepatitis C virus-specific CD8+ T cells with viral clearance in acute hepatitis ... NH, Gerlach JT, Jung MC, Wierenga EA, Pape GR: Different levels of T-cell receptor triggering induce distinct functions in hepatitis B and hepatitis C virus-specific human CD4(+) T-cell clones ... subjects with spontaneous viral clear- A weak protective association of Cw*05 has been observed in European Caucasians[15] Surprisingly, HLACw*05 frequency in chronic infection and viral clearance...

Ngày tải lên: 12/08/2014, 04:21

... recognize specific immunoglobulins in chronic HCV patients, 100 chronic patients and 25 healthy controls were recruited for analysis of specific IgG titers Using a cutoff of recognition calculated ... Evaluation of hepatitis C virus glycoprotein E2 for vaccine design: an endoplasmic reticulum-retained recombinant protein is superior to secreted recombinant protein and DNA-based vaccine candidates ... Bukh J, Purcell RH, Davis HL: DNA-based vaccination against hepatitis C virus (HCV): effect of expressing different forms of HCV E2 protein and use of CpGoptimized vectors in mice Vaccine 2002,...

Ngày tải lên: 12/08/2014, 04:21

... Glucose intolerance in liver cirrhosis: role of hepatic and non-hepatic influences Eur J Clin Chem Clin Biochem 1994, 32(10):749-58 Del Vecchio Blanco C, Gentile S, Marmo R, Carbone L, Coltorti ... participated in data collection and Statistical analysis GE Participated in drafting of the study design NS Participated in study coordination GP Participated in Data collection EO Contributed in ... being infected with HCV might suffer from insulin resistance resulting in more adverse effects of diabetes than those with HCV infection alone It was observed from this study that the occurrence...

Ngày tải lên: 12/08/2014, 04:22

... study of HCV infection and antiviral drug studies in more polarized, xenobiotically-competent cells Figure Robust HCVcc infection in 3-D Huh7 RWV cultures Robust HCVcc infection in 3-D Huh7 RWV cultures ... permissiveness of the cell for HCVcc infection [10,11], we sought to determine if Huh7 3-D cultures were permissive for HCVcc infection As such, 3-D Huh7 cultures were inoculated with HCVcc JFH-1 1, ... Hepatitis C Virus infection in phenotypically distinct Huh7 cell lines PLoS ONE 2009 in press Uprichard SL, Chung J, Chisari FV, Wakita T: Replication of a hepatitis C virus replicon clone in mouse cells...

Ngày tải lên: 12/08/2014, 04:22

... Positive predictive evidence early in the course of treatment could be used for reinforcing the importance of compliance in ensuring a successful outcome Conversely, negative predictive capability ... R, Sacchi P, Ciappina V, Zochetti C, Patruno S, Maiocchi L, Filice G: Viral dynamics and pharmacokinetics of peginterferon alpha-2a and peginterferon alpha-2b in naive patients with chronic hepatitis ... insights into the HCV dynamics, the mechanisms of action of interferon as well as the consequences of varying dosages of interferon [14] The high turnover rates of HCV explain the rapid generation of...

Ngày tải lên: 13/08/2014, 13:20

... Doroudi T: The efficacy of blood donor screening in reducing the incidence of hepatitis C virus infection among thalassemic patients in Iran Transfusion Today 2002, 53:3-4 Alavian SM, Einollahi B, Hajarizadeh ... of liver biopsy, and child score and status (inactive, chronic, cirrhotic and active) of the disease; revealing inexistence of any association between disease severity (grade, stage, child score ... genotypes Accurate knowledge of HCV genotypes in our community is essential for successful future research into vaccine development and control strategy Such information is needed to correctly formulate...

Ngày tải lên: 13/08/2014, 13:20