replacing the default ui of a control
Internal Audit 2012*: A study examining the future of internal auditing and the potential decline of a controls-centric approach docx
Ngày tải lên :
23/03/2014, 04:20
... States, the internationalization of accounting standards may lead to a change in the language of accounting • The growth of outsourcing and an upsurge in the offshoring of services and manufacturing ... risk assurance and thus move up the vertical axis of the Internal Audit 2012 Value Model to demonstrate more value Some proactive internal audit groups have already taken the lead in the area of ... CAE of a global defense and aerospace company that buys parts from around the world said that vendor quality and standards are of primary concern to all global companies She said that when she assesses...
- 68
- 456
- 0
Báo cáo khoa học: "Impact of computerized physician order entry on medication prescription errors in the intensive care unit: a controlled cross-sectional trial"
Ngày tải lên :
25/10/2012, 10:39
... acquisition, analysis of the data, statistical analysis and drafting of the manuscript BC was responsible for data acquisition, analysis of the data, and drafting of the manuscript JD was responsible ... clearance less than 50 ml/minute The parameters needed to calculate the creatinine clearance were always available in both the PB-U and the C-U In addition to the pharmacists' own professional ... macist retrieved information out of the medical and nursing file and the laboratory data Renal function was noted for every patient and renal failure was defined as calculated creatinine clearance...
- 9
- 738
- 1
báo cáo hóa học:" Research Article Note on the Persistent Property of a Discrete Lotka-Volterra Competitive System with Delays and Feedback Controls" pptx
Ngày tải lên :
21/06/2014, 11:20
... Gopalsamy, Stability and Oscillations in Delay Differential Equations of Population Dynamics, vol 74 of Mathematics and Its Applications, Kluwer Academic Publishers, Dordrecht, The Netherlands, ... LotkaVolterra competitive system with delays and feedback controls,” Journal of Computational and Applied Mathematics, vol 211, no 1, pp 1–10, 2008 S Ahmad, “On the nonautonomous Volterra-Lotka ... competition equations,” Proceedings of the American Mathematical Society, vol 117, no 1, pp 199–204, 1993 S Ahmad and A C Lazer, “On the nonautonomous N-competing species problems,” Applicable Analysis,...
- 9
- 351
- 0
The Marketing Strategy of a multinational join stock company.doc
Ngày tải lên :
27/10/2012, 16:51
... another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage the use of capital ... and the theory that will be later based on to research The definition, the goals of marketing , the contents of marketing as well as implementation and control are main parts of chapter one Gaining ... company specializes in selling the following: Air conditioners of famous companies such as Toshiba(Japanese), Mitsubishi(Japanese), Trane(American) and Sanyo(Japanese) Medical and technical equipment...
- 25
- 623
- 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx
Ngày tải lên :
24/12/2013, 01:17
... Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the DefaultValue property of the DataColumn SetNull Indicates ... ENUMERATION MEMBERS CONSTANT DESCRIPTION Cascade Indicates that the delete or update to the DataRow objects in the parent DataTable are also made in the child DataTable This is the default None ... that the DataColumn values in the child DataTable are to be set to DBNull By default, UpdateRule is set to Cascade; therefore, when you change the DataColumn in the parent DataTable on which the...
- 6
- 428
- 0
Tài liệu Báo cáo khoa học: Involvement of two positively charged residues of Chlamydomonas reinhardtii glyceraldehyde-3-phosphate dehydrogenase in the assembly process of a bi-enzyme complex involved in CO2 assimilation doc
Ngày tải lên :
19/02/2014, 16:20
... PsativumA SoleraceaA 197 Chlamy 200 Synechocystis 198 Synechococcus 199 R R R R R R R R R R R R R R R R R R R R A A A A A A A A A A R R R R R R R R R R A A A A A A A A A A A A A A A A A A A A A ... T T T T T G G G G G G G G G G A A A A A A A A A A A A A A A A A A A A K K K K K K K K K K A A A A A A A A A A V V V V V V V V V V S S S S A A A S A A L L L L L L L L L L V V V V V V V V V V L ... with NADH and NADPH, but the catalytic rate constant using NADPH was only half that of the wild type The catalytic efciency, expressed as kcat/Km, of the R197E mutant using NADPH was then about...
- 8
- 494
- 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx
Ngày tải lên :
19/02/2014, 19:20
... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... disambiguation In the 12th Conference of the European Chapter of the ACL Satanjeev Banerjee and Ted Pedersen 2003 Extended gloss overlaps as a measure of semantic relatedness In Proceedings of the ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational...
- 5
- 585
- 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf
Ngày tải lên :
21/02/2014, 01:21
... d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A d(5¢-TCT ACTGCTAACGCGGATTCTCCGCTG) following the manufacturer’s ... induced simultaneously after inoculation of media with cultures grown to exponential phase in the absence of paraquat and IPTG (Materials and methods [24]) The final concentration of paraquat and IPTG ... (equal to unit of SOD activity under standard conditions) After incubation of aliquots at the required temperature or after addition of sodium azide at the required concentration, Vs was measured...
- 12
- 740
- 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
Ngày tải lên :
07/03/2014, 14:20
... functionality of such a triad is affected by the surrounding residues The results so far indicate that larger parts of the polar core of the catalytic TIM barrel of family 18 chitinases play a role ... mutant retains considerable activity, whereas the D14 2A mutant does not It has been shown by X-ray crystallography that replacement of the Asp142 analogue by alanine in other family 18 chitinases ... environmental factors that are taken into account in the calculations (background charges, desolvation penalty and the interaction with other titratable residues), the first factor was found to be the major...
- 10
- 651
- 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx
Ngày tải lên :
08/03/2014, 02:21
... discusses the use of HHMMs for the text chunking task and the grammar parser The evaluation results of the HMM, the plain HHMM and the merged and partially flattened HHMM are presented in Section Finally, ... chunking task The results suggest that the partial flattening process is capable of improving model accuracy when the input data contains complex hierarchical structures The evaluation involves analysing ... (grammar parsing) at least as accurately as the HMM This is assignment is a task that HHMMs are generally not well suited to Table shows the F1 -measures of identified semantic roles for each...
- 8
- 528
- 0
Báo cáo Y học: Subsite mapping of the binding region of a-amylases with a computer program ppt
Ngày tải lên :
08/03/2014, 09:20
... SUMA software: subsite mapping of amylases This software calculates the apparent binding energies on the basis of the measured bond cleavage frequencies The calculations are based on the equation: ... Subsite map of barley a- amylase isoenzyme The binding a nities were calculated according to the data of Table Fig Subsite maps for porcine pancreatic a- amylase (PPA) The solid bars are related to ... can vary according to the calculations The primary calculated subsite energy values can be refined to the best agreement of the measured and recalculated BCF data by the iteration Fig shows the...
- 6
- 387
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
Ngày tải lên :
08/03/2014, 22:20
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a ... free radicals at the surface of the epidermis Biochem Biophys Res Commun 136, 630–637 16 Nakamura, H., Matsuda, M., Furuke, K., Kitaoka, Y., Iwata, S., Toda, K., Inamoto, T., Yamaoka, Y., Ozawa,...
- 9
- 533
- 0
Báo cáo Y học: Kinetic and biochemical analyses on the reaction mechanism of a bacterial ATP-citrate lyase ppt
Ngày tải lên :
08/03/2014, 22:20
... phosphorylation of the a subunit Another function of AclB was found to be stabilization of the enzyme, as AclB prevented the degradation of AclA that was otherwise observed in the absence of AclB After ... into account the reaction mechanism of mammalian ACL [23], the nal step of the reaction can be assumed to be the nucleophilic attack of CoA to the phosphorylated carbonyl carbon of citryl phosphate, ... dissociation (AB) are shown in lanes and 4, the individual AclA subunits (a) are shown in lanes and 5, and AclB subunits (b) in lanes and Molecular masses (kDa) are indicated on the side of each panel The...
- 8
- 551
- 0
Báo cáo " Influence of laser parameters on the stationary operation of a two-mode random micro laser " pdf
Ngày tải lên :
14/03/2014, 13:20
... studying the influence of laser parameters on saturated values of mode photon densities, we vary one of parameters in table and remain invariable all the rest of parameters The obtained results are ... Mathematics - Physics 23 (2007) 139-142 Discussion and conclusion In the stationary operation of two-mode random microlaser, the variation of laser parameters influences clearly on the transformation ... reveals that the increase of one mode photon density caused in the decrease of the other one Fig 1a Gain coefficient α1 varies Fig 1b Gain coefficient α2 varies D.V Hoang, M.H Hanh / VNU Journal...
- 4
- 343
- 0
Đề tài " On the Julia set of a typical quadratic polynomial with a Siegel disk " ppt
Ngày tải lên :
14/03/2014, 22:20
... S1 at Lemma 4.10 There exist the following asymptotically universal bounds: n area(P0 An+2 ) n area(P0 n area(Pqn+1 An+2 ) n area(Pqn+1 area(Qn An+2 ) area(Qn An+2 ) An+2 ) An+2 ) n n area(P0 ... neighborhood of U {x(U )}, where x(U ) is the root of U The boundary of each puzzle piece P consists of a rectifiable arc in A( ∞) and a rectifiable arc in J(F ) The latter arc starts at an iterated preimage ... Annals of Mathematics, 159 (2004), 1–52 On the Julia set of a typical quadratic polynomial with a Siegel disk By C L Petersen and S Zakeri To the memory of Michael R Herman (1942–2000) Abstract...
- 53
- 383
- 0
Đề tài " The diameter of the isomorphism class of a Banach space " pdf
Ngày tải lên :
15/03/2014, 09:20
... Tzafriri, Classical Banach Spaces I Sequence Spaces, -index of a Banach space, Israel J Springer-Verlag New York (1977) [Mc] R A McGuigan, Jr., Near isometry of Banach spaces and the Banach-Mazur ... lemma follows from Lemma and the the classical fact that every separable Banach space 1-embeds into C[0, 1] Lemma is false for some nonseparable spaces Partington [P] and Talagrand [T] proved that ... Annals of Mathematics, 162 (2005), 423–437 The diameter of the isomorphism class of a Banach space By W B Johnson and E Odell* Dedicated to the memory of V I Gurarii Abstract We prove that...
- 16
- 376
- 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc
Ngày tải lên :
16/03/2014, 00:20
... ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues against ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of ... assays, the commercially available quality control strain E coli ATCC 25922 was used The bactericidal activity of Esc(1–18) against E coli ATCC 25922 was evaluated by a liquid microdilution assay...
- 18
- 494
- 0
Báo cáo khoa học: The identification of a phospholipase B precursor in human neutrophils doc
Ngày tải lên :
16/03/2014, 04:20
... FLJ22662 and a putative PLB An attempt was made to purify the 22 ⁄ 42 kDa doublet based on deacylation activity However, the deacylation activity in the acid extracts of granules was low and the activity ... protease contamination of the purified protein preparations was ruled out by the absence of bacterial DNA and the absence of protease activity The former analyses were performed at the routine Department ... molecular masss are indicated in lane Lane 2, material from the acid extracts of granules; lane 3, material from fractions 58–69 of the Sephadex G-75 purification step; lane 4, material from the...
- 12
- 486
- 0