relationship between moduli of elasticity e and g

... no evidence was detected of an inverse relationship between the increase in sales of SSRIs and declining suicide rates In interpreting these findings, we need to keep in mind that there are factors ... We found no negative association between the increasing sales figures of SSRIs and the declining Table Numbers of SSRI differences and suicide rate differences below and above the median Table ... figures of SSRIs increased more than the sales figures of TCAs declined, allowing more people to be treated; however, there is no Page of association between increased sales of SSRIs and decrease in...

Ngày tải lên: 11/08/2014, 16:22

... according to the result, there are only 111 people respond to the questionnaire, other 49 people refuse to answer The filled-in questionnaire is going to be classified into categories of age, gender, ... The aim of this study is to figure out the relationship between CSR implementation and the development of five selected company in Ha Noi from the viewpoint of 20 managers and employees of these ... the competition between foreign companies and local companies becomes stronger than ever According to Dr Le Dang Doanh, Member of the Board and Senior Research Fellow of the Vietnam Institute of...

Ngày tải lên: 13/03/2014, 14:20

... filling was a blend of ingredients (200 g of macerated cabbage, 100 g of fried egg, 10 g of oil, g of shallot, g of ginger, g salt, and g monosodium glutamate) mixed in a plastic container Fried egg ... materials, whereas vegetable-filled types are made from dough, eggs, vegetable and auxiliary materials, or without eggs Although no official data are available, it is generally agreed that Chinese ... with three measurements being made on each side of the dumpling sheet Raw dumpling sheets were measured after sheeting (0 h), and again after h of storage in a covered plastic container at 25°C...

Ngày tải lên: 05/05/2014, 08:43

... prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction ... prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction ... prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction...

Ngày tải lên: 03/06/2014, 00:50

... gathered pre-treatment (at study entry) General linear mixed models were used to assess the relationship between the EQ-5D index and a series of explanatory variables, allowing for heterogeneity ... heterogeneity between studies by taking the sum of the squared differences of each study from the pooled estimate, weighted in the same way in which studies were weighted to get the pooled estimate ... between studies, or here, between disease/treatment groups Results Study sample sizes ranged between 68 and 2419 (Table 1) The EQ-5D index had more of a ceiling effect in healthier patients being...

Ngày tải lên: 18/06/2014, 19:20

... a few per cent Therefore, the method is suitable with regard to detecting the tendency of the H change in the samples as presented in the next section However, the absolute error is worse because ... grew the samples by sputtering and suggested the experiment, NQK performed the ERDA measurements, ACs carried out the sample heating experiments, FR did the Makyoh topography measurements, ZE ... in the sputtering chamber The presence of the Ge di-hydride on the high wave number side of the Ge-H peak is not certain The possible existence of Si-H2 bonds could be suggested by spectrum B2...

Ngày tải lên: 21/06/2014, 05:20

... were excluded from the sample, as the study trees were going to be felled After this, trees and clones were selected to scan the full remaining range of variation for height and DBH The same ... January There are smaller, yet still high coefficients between the July and the January measurements Figure3 presents trunk MOE estimations at tree, clone and date of measurement levels There is also ... relationship between the stem taper and the MOE: therefore, the cylindrical stem assumption cannot be rejected Nor is there a relationship between the trunk MOE and the water content of the stem at the...

Ngày tải lên: 08/08/2014, 14:21

... cumulated density for the high density segment (Dcu), energy (Ene) and number of crossing points between the dc line and the profile (Nb) Figure illustrates these parameters Dcu is the surface between ... relationship between the density parameter and the MOE is maximum Figure shows an example of the evolution of the r of the relationship between the MOE and one parameter, Ene, when dc varies from ... stiffness of standing tree trunks (trunk MOE) Fairly strong positive relationships between MOE and specific gravity of samples of different shapes and sizes have often been reported: e. g on standard...

Ngày tải lên: 08/08/2014, 14:21

... Manson et al between groups) suggested that there was no real difference in the levels between partial and complete remission The partial and complete remission categories were combined such ... IgG antibodies with well-defined anti-nucleosome-binding properties [23] were used as positive and negative controls To standardise results between ELISA plates, readings were taken when the ... levels remained high throughout the observation period whereas levels of the other two autoantibodies remained low However, there was no clear relationship between anti-α-actinin levels and serum...

Ngày tải lên: 09/08/2014, 14:22

... see that in all three GO categories the average size of the GO groups decreases in most of the cases as their level increases Figure 3.7 Number of proteins across different GO levels The numbers ... from level to suggesting that there is a steep increase in the similarity between the protein sequence pairs when we go from level to The level of a GO term is defined as the lowest level on ... ontologies and the genes and gene products • Development of tools that can help in the making, maintaining and using ontologies The Gene Ontology (GO) project describes the gene products in terms of...

Ngày tải lên: 30/10/2014, 20:13

... observing, selecting and organizing, people perceive data information from outside However, because of the imbalance level of knowledge, sometimes lead to misperceive Indeed, many classic research ... studies clearly showed that in workplace, managers and subordinates often have different perception “The manager and the employee perceive the job design freedom in different ways; they have different ... other hand, Ballmer has reduced a level of management to manage more easily and efficiently Microsoft structure is less flat therefore, the span of control is narrower and the gap between the...

Ngày tải lên: 12/04/2013, 21:50

... under reduced pressure at room temperature until ethanol and methanol were removed followed by drying in a freeze-dryer The dry extracts (extractable phytochemicals) represented 24.8% of the rice ... at the level of 106.01 mg/kg Other vitamin E components were not detected in the dichloromethane fraction of FFRB The level of γ-oryzanol (2813.59 mg/kg) was 27 times higher than the level of vitamin ... analyses Calibration curves of each standard were created from seven concentrations using Microsoft Excel software The concentrations of individual components in the rice samples were determined...

Ngày tải lên: 15/03/2014, 15:33

... languages continues to grow across different languages both for the top ten (see Figure 9) and bottom ten (see Figure 10) languages indexed Blogger language selection page at: http://www.blogger.com/language .g ... these three elements are connected and feed into each other in a virtuous circle The inter-linkages between the different elements lead to three key lines of policy considerations evolving out of ... Lacklustre penetration rates could mean slower economic growth among countries looking to enter into the group of developed economies between Internet 117 Even though the aggregated effects are still...

Ngày tải lên: 23/03/2014, 03:20

... GGGGGATCCCCATAATCCACTCCACCTGCTAAA GGGGGGGATCCT CATTATTTCCCTTCT AATACCGCCATGTATAATATCTATTACTTC GTAATAGATATTATACATGGCGGTATTGAA GGGGGGGCCATGGAAAGAGCAGACGATTT Large-scale protein expression and purification Cultures were grown ... Table PCR primer names and sequences Primer name Sequence 21 33 40 41 44 66 67 75 GGGTCTAGAATGGAAAAAGATCTACAGTTAAGA CCGGAATTCTTATTTCCCTTCTCTCATCTC GCGCGCCATGGAAAAAGATCTACAGTTAAGA GGGGGATCCCCATAATCCACTCCACCTGCTAAA ... nucleotide sequence of the ora genes in order to facilitate the amplication by PCR An NcoI site was introduced into the start of the oraS gene and a BamHI site into the end of the oraE gene Genomic...

Ngày tải lên: 30/03/2014, 15:20

... other fields converge with the evidences reviewed here, and (2) whether the psychoanalytic perspective is given credence There is already ample evidence to support the role of Cg25, the vmPFC and ... positively correlated with the seed region (i9) and blue indicates regions negatively correlated with the seed region The seed region, i9, fell within the area of Cg25 This region's network of connectivity ... Significant improvements were seen in sleep, energy, interest and psychomotor speed Patients and their families reported 'renewed interest and pleasure in social and family activities, decreased...

Ngày tải lên: 08/08/2014, 23:20

... following one of three schemes, i .e. , random selection, selection on the basis of highest phenotypes, and selection on the basis of highest estimated breeding values The last two gave different degrees ... showed the same pattern regarding the biases of both predicted breeding values and estimated contrasts of CG effects The small differences between biases of the two methods were (Tab II), however, ... effects of CG were not estimable when they were treated as fixed effects Thus, the estimable contrasts between each level of CG effect and the first level were used to calculate the rank correlation,...

Ngày tải lên: 09/08/2014, 18:21

... follicles and the level of FSH during the prepuberal period (D E EVIERS R & M 1979) However, these discrepancies observed between breeds , ON T AUL cannot question the relevance of the FSH levels ... classified by a progeny test at an early age (before the decision concerning ewe replacement must be made) For this early estimation of sire breeding value the total number of offsprings and therefore ... in selection schemes for reproductive rate Prepuberal Nevertheless, FSH a Received December 7, 1987 Accepted April 1, 1988 Acknowledgements We thank : the breeders of the Lacaune meat selection...

Ngày tải lên: 09/08/2014, 22:22

... different levels of TLC cut-off values among those who were less than 18 years of age and adults are depicted in table Considering the best cut-off values of TLC, that are with the highest sensitivity ... Nurse, Cancer Research UK Your research papers will be: available free of charge to the entire biomedical community peer reviewed and published immediately upon acceptance cited in PubMed and ... count below 200 cells/mm3 [10,11] This necessitates further study on the relationship between TLC and CD4 Therefore, the objective of this research was to assess the relationship between total...

Ngày tải lên: 10/08/2014, 05:21

... 87,.81, respectively) Questions relating to drug and alcohol dependence were excluded from analysis given the present study’s objective of evaluating the relationship between substance use and symptoms ... were interviewed regarding demographics, methadone treatment (see Table 1), and current and lifetime substance use [22] For 19 different substances (see Table 2), participants were asked whether ... upon reporting (or not reporting) substance use, there was no motivation to minimize or exaggerate any substance use Indeed, Page of 10 when assessed, the test-retest reliability of the present...

Ngày tải lên: 11/08/2014, 18:20

... Given the relatively small gastric nutrient load and high frequency of delayed GE (64%), the existence of the relationship between GE and the hormonal release may simply reflect the level of ... plotted, and the resultant curves were used to calculate a GE coefficient (GEC) [41], using non-linear regression formulae: GEC = ln(y)) and y = atbe -et, where y is the percentage of 13CO2 excretion ... minimized the adverse impact of hyperglycaemia on the rate of GE Whilst the present observations strengthen the rationale for the potential use of CCK antagonists in the management of feed intolerance...

Ngày tải lên: 13/08/2014, 08:21