regulation of synaptic fusion by heterotrimeric g proteins

... amplification protocol according to manufacturer's instructions Primer sequences for rat iNOS were as follows; forward 5'-CAC GGA GAA CAG AGT TGG-3' and reverse 5'-GGA ACA CAG TAA TGG CCG ACC-3' Amplified ... consequence of simultaneous but independent signaling of both types of NGF receptors [79] or recruitment of intracellular signalling elements uniquely driven by the simultaneous activation of both NGF ... signaling pathways that require the simultaneous expression of both TrkA and p75NTR [71,72] as well as the convergence of TrkA and p75NTR-mediated signaling impinging upon NF-κB [73] Page 10 of...

Ngày tải lên: 19/06/2014, 22:20

... GEF ΔKIND1+2-Flag dendrite axon ΔGEF-Flag KIND1-Flag KIND2-Flag α-Flag ΔRasN-Flag EGFP + α-Flag Fig Domain structure of the MAP2-associated RasGEF v-KIND and its dendritic targeting via KIND2 domain ... cerebellar granule cells and hippocampal neurons, suggesting that v-KIND acts as a signaling molecule in controlling or limiting dendrite growth of neurons during development [12] We also suggested ... (Fig 5B) These results suggest that KIND2 and KIND2-1, overexpressed in neurons, act as dominant-negative regulators of v-KIND and suppress the negative regulation of dendrite growth by endogenous...

Ngày tải lên: 14/02/2014, 19:20

... 5¢-TTCCTCCAACCACAGCACATAC-3¢); UBC9 (sense, 5¢-CAACAAAGAACCCTGATGGCACGA-3¢ and antisense, 5¢-GCATCCGTAGCTTGAACAAGCCTC-3¢); PIAS3 (sense, 5¢-ACTGCAGGGACCCTGCTACA-3¢ and antisense, 5¢-CTTGATCAGTGCTCGGGAATG-3¢); ... 5¢-GAGAATCCAGCTTCTTTCCC-3¢ and antisense, 5¢-GGCGACACTGTATGAATTGC-3¢); SENP2 (sense, 5¢-AACAGTCTCTACAATGCGGCCA-3¢ and antisense, 5¢-CCGTGTTCCATTACAAGCAGAA-3¢); SAE1 (sense, 5¢-GACCTGCTTCCCGATGACTTT-3¢ ... F.-M Yang et al (sense, 5¢-GGGAAATCGTGCGTGAC-3¢ and antisense, 5¢-CAAGAAGGAAGGCTGGAA-3¢) The PCR conditions were 95 °C for 10 min, 40 cycles of denaturation at 95 °C for 15 s, and annealing and...

Ngày tải lên: 23/03/2014, 06:20

... http://www.jneuroinflammation.com/content/8/1/118 Page of 18 Figure Representative images of H&E-stained sections, highlighting cerebral sparing by high dose gelsolin in burn-injured mice Cortex of control mice (A) and ... condition of sepsis [28] It could solubilize circulating actin aggregates and Page of 18 shift expressed cytokines toward an anti-inflammatory profile [28], resulting in a significant reduction of mortality ... magnetic resonance imaging has identified marked changes in the brain up to days postburn (pb), most notably swelling and lesions [5], changes in cerebral blood flow [6], dysregulation of glucose...

Ngày tải lên: 19/06/2014, 22:20

... pathways involved in regulating cap-dependent protein translation in cultured trigeminal ganglion (TG) neurons from mice grown in the presence of NGF (50 ng/ml) for days TG cultures were treated ... resveratrol is capable of blocking signaling via ERK or mTOR engaged by extracellular signals Hence, we asked whether resveratrol blocks IL-6-induced changes ERK/eIF4E signaling in primary afferent ... by endogenous signaling factors that act on these pathways [45] A crucial kinase for negative regulation of translation is the ubiquitous, energy-sensing kinase AMPK Activation of AMPK by depletion...

Ngày tải lên: 21/06/2014, 19:20

... CTCATCACCGACACCACCAACC-3', reverse 5'TCCCACGAAGCAGCGACAGT -3', 608 bp; COL2A1 (GeneBank:NM_033150), forward 5'- CCCTGAGTGGAAGAGTGGAG -3', reverse 5'- GAGGCGTGAGGTCTTCTGTG -3', 511 bp; Aggrecan (GeneBank:NM-001135), ... (GeneBank:U24163), forward 5'GGGCTATGAAGATGAGGAACGT-3', reverse 5'-ACCGAGTCGATCCTTCCACTT-3', 79 bp; β catenin (GeneBank:X87838), forward 5'CCAGCCGACACCAAGAAGCA-3', reverse 5'-GCGGGACAAAGGGCAAGATT-3', ... 5'CTGGAGTTCTTTGAAATGTGCT-3', reverse 5'- AAGGTTAGCTCCCATGATTCTC-3', 133 bp; LEF-1 (GeneBank:NM_016269), forward 5'- CAGAGAAAGGAGCAGGAGCCAA -3', reverse 5'- TGATGTCAGTGTTCCTTTGGCG -3', 481 bp; TCF-1 (GeneBank:NM000545),...

Ngày tải lên: 09/08/2014, 08:22

... of NGF (Fig 3, lane 1) Removal of NGF for 7.5 h after 72 hours of differentiation led to a significant reduction of ERK1/2 and Akt phosphorylation (Fig 3, lane 2) Exogenous addition of 100 ng/ml ... Park S, Christofferson R, Kamihara J, Ding YH, Lo KM, Gillies S, Folkman J, Mulligan RC, Javaherian K: Oligomerization-dependent regulation of motility and morphogenesis by the collagen XVIII NC1/endostatin ... containing 50 ng/ml human recombinant NGF (PAN Biotech) for days [18] Although Fc-endostatin dimer application induced the formation of multicellular PC12 aggregates on Matrigel [8], Matrigel was...

Ngày tải lên: 11/08/2014, 08:20

... showed distinguishable profiles of GO categories, both for genes experiencing transcriptional changes and for those genes showing changes in alternative splicing These results suggest that, as ... affected by changes in alternative splicing of the genes involved Indeed, signaling genes were among the enriched categories of differentially spliced genes upon activation of the wingless pathway ... cg1141, wdb, cg3168, cg8789, cg32425, cg16833, cg13499, cg4502, cg31732, cg32103, cg33085, sesB, scb, sdc, nemy, Ef2b, keap1, drpr, cg15105, : cg5059, spi, cg6231, cg14869, cpx, spri, cg16758, dom,...

Ngày tải lên: 14/08/2014, 21:20

... neurons may be separated from a glial signal The location of the CNTF suggests the possibility that CNTF might have an effect on maturing neurons and glia as suggested by Henderson et al [11] This ... formation of the neuronal and glial pathways Different neurotrophic factors and proteins affected neurons and glia during developmental In the former study regarding the distribution of NGF-, GFAP- ... Chi-Won Song, Hyo-Jung Kwon, Mi-Sun Park, Mi-Young Lee, Keun-Jwa Lee, Young-Gil Jeong, Chul-Ho Lee, Kwon-Soo Ha, Man-Hee Rhee, Kang-Yi Lee and Moo-Kang Kim b Table Distribution of GFAP-IR in...

Ngày tải lên: 07/08/2014, 15:20

... familiaris nerve growth factor beta (5′-ATGTCCATGTTGTTCTACACTCTGAT CACAGCTCTTCTGATCGGCATCCGGGCAGAACC GCATCCAGAGAGCCATGTCCCAGCAGGACACGC CATCCCCCACGCCCACTGGACTAAGCTTCAGCAT TCCCTT-3′; GeneBank sequence ... for (Fig 1) PCR using the primers NGF-2F (5'-AGTTCT CGGTGTGCGACAG-3') and NGF-2R (5'-GCCCAGGA GAGTGTGGAG-3') was also performed for 35 cycles at o o o 94 C for min, 55 C for and 72 C for (Fig 1) ... sequences of human and mouse β-NGF genes to amplify partial dβ-NGF sequences PCR using the primers NGF- 1F (5'-TCAGCATTCCCTTGACACWG-3') and NGF-1R (5'-AGCCTTCCTGCTGAGCAC-3') was performed for o...

Ngày tải lên: 07/08/2014, 23:22

... TGF-β signaling induced as a repair response to IL-1 is curtailed by TGF-β depleting LAP The LAP binds to TGF-β and prevents its bioavailability to the receptors Although it is clear that TGF-β-mediated ... examined TGF-β in the knee joints of mice aged months or years The mice were challenged with IL-1 to initiate cartilage catabolism The authors examined the response of the articular cartilage to TGF-β1 ... in the joints of young and old mice In 2-yearold mice there was a decline in the expression of TGF-β2, TGF-β3 and TGF-β receptor It is noteworthy that the number of cells expressing phosphorylated...

Ngày tải lên: 09/08/2014, 07:20

... evaluation of pathogenic mechanisms and the development of new therapeutic strategies (e .g the pharmacological blockade of the NGF receptor and their signaling pathway by using receptor antagonists) ... given target gene and the G3 PDH gene Delta Ct was determined as the mean of the duplicate Ct values for the target gene subtracted by the mean of the duplicate Ct values for the G3 PDH gene For ... the pathogenesis of psoriasis Prog Brain Res 2004, 146:433-437 Reinshagen M, von Boyen G, Adler G, Steinkamp M: Role of neurotrophins in inflammation of the gut Curr Opin Investig Drugs 2002,...

Ngày tải lên: 09/08/2014, 14:21

... CATACCCTGGGTTTTCCTCCAA; reverse primer: GTCCGCTGCAAAGAAGTATGTTTTC; probe: CTGCATCAATTTTCC), IL-1β (forward primer: CGGCCACATTTGGTTCTAAGA; reverse primer: AGGGAAGCGGTTGCTCATC; probe: ACCCTCTGTCATTCG), ... the degree of morphological degeneration was graded according to previously published criteria [3] The grading system generates a score of between and 12: a grade of to represents a histologically ... (moderate degeneration) and 10 to 12 (severe degeneration) (P < 0.05) (Figure 3) Figure Figure histological grade of the percentage surgical degenerate in postmortem samples classified according immunopositive...

Ngày tải lên: 09/08/2014, 14:22

... observations suggest an autocrine loop of NGF for FLS proliferation and suggest that dysregulated production of NGF has the potential to influence the inflammatory and proliferative cascades of PsA and ... underlying cortical bone [4] We noticed that proinflammatory cytokines upregulate NGF/TrkA in FLSs, NGF/TrkA is upregulated in FLSs of inflammatory arthritis (Table 1), and NGF is mitogenic to FLSs (Figure ... influence angiogenesis and cell trafficking [3] In patients with RA or PsA, pannus tissue adheres to the surface of articular cartilage; proliferating FLSs produce proteinases that degrade cartilage and...

Ngày tải lên: 12/08/2014, 14:21

... mediated by both FGF10 and FGF7 activation of FGFR2b This is mediated downstream by activation of specific target genes FGF signaling promotes outgrowth of lung epithelium The mouse embryonic lung represents ... Fibroblast Growth Factor10 (FGF10) and cognate FGF receptors (FGFR1b and FGFR2b) FGF10 can activate both FGFR1b and FGFR2b On the other hand, FGF7 only activates FGFR2b Activation of FGFR1b by FGF10 ... possible that VEGF signaling may lie downstream of FGF signaling, since in vivo abrogation of FGF signaling severely affects both epithelial and endothelial morphogenesis Figure Growth factor interactions...

Ngày tải lên: 13/08/2014, 13:20

... initial signal triggering molecular osmosensors Equilibration of intracellular ionic strength during gradual osmolality changes can be achieved without osmosis if the capacity of ion transport proteins ... a Grail ⁄ Goliath homolog in tilapia [26], suggesting that they are fundamentally important in the osmotic stress response of fish Ubiquitin E3 ligase may sense protein damage by quantifying the ... insertion of nascent ion transport proteins and changes in activity of existing ion transport proteins The second phase long-term response is regulated primarily by genomic actions of corticosteroids,...

Ngày tải lên: 18/02/2014, 16:20

... integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling Similarly, sensing of glutamine-induced hepatocyte swelling by integrins feeds into Src-dependent ... which localizes downstream of the ROS production triggered by Osmosensing and signaling in mammalian cell function Fig Hepatocyte shrinkage and the production of reactive oxygen species constitute ... autoamplificatory signaling loop Hyperosmotic shrinkage triggers a NADPH oxidase-catalyzed ROS formation ROS, again by stimulating K+-efflux, antagonize processes underlying the RVI, and thereby increase...

Ngày tải lên: 18/02/2014, 16:20

... stimulate Gi signaling pathways in the absence of secreted ADP and cause human platelet aggregation independently of Gi signaling Blood 99, 3629–3636 Jin J & Kunapuli SP (1998) Coactivation of two ... change was measured in PRP or washed platelets by turbidometry in the presence of tirofiban to prevent aggregation Shape change evoked by up to 20 lm ADP was not significantly (< 10%) influenced by ... enhancement of thrombin receptor signaling, which is most prominent in the late stage of the Ca2+ response 380 and is quite substantial in longer-term Ca2+ integrals This long Ca2+ signal is shortened by...

Ngày tải lên: 18/02/2014, 16:20

... inhibition of Rho GTPase signaling [23,24] These data pinpoint to an important role for RhoA GTPase signaling in CTGF/CCN2 gene regulation Incubation of various cell types with stimulatory agents triggers ... expression CTGF /CCN2 gene regulation through MAP kinase signaling Because Rho GTPases regulate cytoskeletal reorganization and gene expression either directly or through the activation of members of the ... affect CTGF /CCN2 expression Increasing amounts of evidence support an obligatory role for the actin cytoskeleton in the regulation of specific genes by small GTPase proteins The morphology of the...

Ngày tải lên: 19/02/2014, 16:20