reflections on a decade of evidence based dentistry

... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... Report of the Surgeon General Atlanta, GA, Dept of Health and Human Services, Center for Disease Control, antional Center for Chronic Disease Preventation and Health Promotion, Office of Smoking and ... ovulation from an ovarian follicle Schematic diagram of an oocyte cumulus complex after ovulation from an ovarian follicle The oocyte and polar body are contained within the zona pellucida Immediately...

Ngày tải lên: 05/03/2014, 17:20

... disambiguation, and a set of linguistic features They test their system against both Lauer’s prepositional paraphrases and another set of 21 semantic relations, achieving up to 54% accuracy on the latter ... SemEval’07 task dataset (Girju et al., 2007), where each example consists of a sentence, a target semantic relation, two nominals to be judged on whether they are in that relation, manually annotated ... The evaluation on several relational similarity problems, including SAT verbal analogy, headmodifier relations, and relations between complex nominals has shown state -of- the-art performance The...

Ngày tải lên: 08/03/2014, 01:20

... through almost all of the traditional ways has fallen Family of origin and primary and secondary school (the “traditional” institutions based around place of origin) had already declined in importance ... find partners To what extent is the partnership rate of heterosexual women of a certain age a reasonable measure of the lack of availability of partners for single men of the same age group (and ... Internet access at home and having a romantic partner is a strong and statistically significant association, several important caveats apply First, as we mention above, there could be reverse causality,...

Ngày tải lên: 15/03/2014, 21:20

... face and the voice went away Sorry because he was afraid Afraid that it was some disease Canker was a disease of plants and cancer one of animals: or another different That was a long time ago ... had a nicer smell than his father She played on the piano the sailor’s hornpipe for him to dance He danced: Tralala lala, Tralala tralaladdy, Free eBooks at Planet eBook.com Tralala lala, Tralala ... the next term and then vacation again and then again another term and then again the vacation It was like a train going in and out of tunnels and that was like the noise of the boys eating in the...

Ngày tải lên: 31/03/2014, 14:20

... state, and national level [3-5] In addition, utilization of HRQOL measures at the population health level may assist in the evaluation of the healthcare needs of a community, and results can be ... assure the anonymity and confidentiality of the respondent's answers and the neutrality of the organization gathering the data, all surveys were mailed back to DataStat Since the intent of the SCHIP ... an alpha of 0.90, recommended for individual patient analysis [40], making the Total Scale Score suitable as a summary score for the primary analysis of HRQOL outcome in population health analyses...

Ngày tải lên: 20/06/2014, 15:20

... endeavored to abide by a Chinese-only principle, English was regularly and strategically employed as an international lingua franca (English as a lingua franca, ELF) for explanatory, managerial and ... class Chinese language teachers are not simply a profession but also a national representative T9 further argued that CFL teaching was a “national profession shouldering the responsibility of ... Narratives of professional learning: Becoming a teacher in learning to teach Journal of Educational Inquiry 1(2): 1-23 Borg, Simon 2006 Teacher cognition and language education London: Continuum Butzkamm,...

Ngày tải lên: 20/06/2014, 21:20

... endeavored to abide by a Chinese-only principle, English was regularly and strategically employed as an international lingua franca (English as a lingua franca, ELF) for explanatory, managerial and ... class Chinese language teachers are not simply a profession but also a national representative T9 further argued that CFL teaching was a “national profession shouldering the responsibility of ... Narratives of professional learning: Becoming a teacher in learning to teach Journal of Educational Inquiry 1(2): 1-23 Borg, Simon 2006 Teacher cognition and language education London: Continuum Butzkamm,...

Ngày tải lên: 21/06/2014, 17:20

... endeavored to abide by a Chinese-only principle, English was regularly and strategically employed as an international lingua franca (English as a lingua franca, ELF) for explanatory, managerial and ... class Chinese language teachers are not simply a profession but also a national representative T9 further argued that CFL teaching was a “national profession shouldering the responsibility of ... Narratives of professional learning: Becoming a teacher in learning to teach Journal of Educational Inquiry 1(2): 1-23 Borg, Simon 2006 Teacher cognition and language education London: Continuum Butzkamm,...

Ngày tải lên: 21/06/2014, 19:20

... Henry Gartside, Esq., of Manchester They are tenable for two years and about three are awarded each year They are open to males of British nationality who at the date of the election shall be ... with a few isolated instances, such as canvas shoe factories and similar works Even the production of such essentially native goods as “ponchos” has lapsed in favour of German and Italian wares ... whole coast is to be found Mar del Plata is the Argentine Brighton, and any commercial development there is certain of an unfavourable reception But as sand and mud are the only base from Santa Fé...

Ngày tải lên: 28/06/2014, 19:20

... raw-materials-to-consumer value chain; value is added at each stage Typically, the primary operations of an organization take place in one of these stages For a company based in the assembly stage, backward ... remain competitive in this market, Matsushita had to place more emphasis on local customization of its Panasonic and JVC brands The advantages and disadvantages of a multidomestic strategy are ... way to compete internationally A basic question confronts the managers of any organization that competes in more than one national market: To what extent should the organization customize features...

Ngày tải lên: 05/07/2014, 19:20

... dna ,tnanimod saw xirtam diordnohc a ,esac siht fo noitanimaxe lacigolohtapotsih eht nO xirtam dioetso dna diordnohc a sniatnoc yllacigolotsih ti dna evah samocrasordnohc sa ecnaraeppa IRM dna ... drehpehs namreG a fo arhteru eht ni samocrasordnohc owT D tloH ,JG sivaD 6991 ,aihpledalihP ,srednuaS ,035-724 pp de dn2 txeT dna saltA citsongaiD a :yhpargonosartlU dna ygoloidaR laminA llamS M namrekcA ... ,ecnaraeppa tneculsnart a evah snoiger dezilarenim-noN eussit-tfos eht otni noisnetxe detaicossa dna noitartenep lacitroc fo saera lacof ni tluser yam taht 004× ,niats E&H )C( tnenopmoc suonigalitrac...

Ngày tải lên: 07/08/2014, 20:23

... varies according to authors, the actual standard karyotype description by GTG- and RBG-banding for the chicken, established by the International Committee for the Standardization of the Avian ... S.E., Delany M.E., Muscarella D.E., Constant and variable features of the avian chromosomes, in: Etches R.J., Gibbins A. M.V (Eds.), Manipulation of the Avian Genome, CRC press, Guelph, Canada, 1993, ... bird karyotypes seem very well conserved between ratites and carinatas !17! The appearance of microchromosomes could precede bird adaptative radiation at the end of the Jurassic, beginning of the...

Ngày tải lên: 09/08/2014, 18:21

... Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association of Oral and Maxillofacial Surgeons position paper on bisphosphonate-related ... Dodson TB, Assael LA, Landesberg R, Marx RE, Mehrotra B: American Association of Oral and Maxillofacial Surgeons position paper on bisphosphonate-related osteonecrosis of the jaws–2009 update ... Cases of ONJ due to osteoporosis bisphosphonate therapy are less frequent [5] Page of Figure a) Intraoral examination of her left upper jaw with fistula formation and pus on palpation in region...

Ngày tải lên: 10/08/2014, 23:20

... MRI also has an advantage over laparoscopy for evaluating pelvic and extraperitoneal diseases, as well as lesions concealed by adhesions excision and was involved in editing the manuscript All authors ... deliveries and had no history of abdominal pain, dyspareunia or infertility She was not using any form of hormonal contraception Her medical history was not significant and she never had any abdominal ... extravasation of the mucinous Umbilical endometriosis: endometriotic glands with metaplasia of the mucinous type and extravasation of the mucinous secretion into the adjacent stroma Majority of...

Ngày tải lên: 11/08/2014, 14:21

... authors state that a lack of conceptual clarity exists between the concept of activity and the concept of participation as operationalized within the ICF, and argue that certain of the domains are ... between rehabilitation professionals and clients in an acute-rehabilitation centre The acute stage of rehabilitation is a particularly important stage in the rehabilitation process as it is the ... both activity and participation, as participation occurs across all the major life activities of an individual [7] Difficulties at this level are described as activity limitations or participation...

Ngày tải lên: 12/08/2014, 00:20

... Futamura T, Toyooka K, Iritani S, Niizato K, Nakamura R, Tsuchiya K, Someya T, Kakita A, Takahashi H, Nawa H: Abnormal expression of epidermal growth factor and its receptor in the forebrain and ... that atrophy of brain regions in depression may be adaptive mechanisms to a chronically deprived and limiting environment, whereas conversely hypertrophy of brain and elevated mood would be adaptive ... pharmacotherapy and psychotherapy, with a treadmill supplanting the proverbial Freudian couch The Romans may have had it right with their ideal of mens sana in corpore sano (a healthy mind in a...

Ngày tải lên: 14/08/2014, 14:21

... Conducted preliminary research on alternative solutions Barbara, Steve and William McDougal: Proceed with analysis before making solution decisions Barbara, Steve: Began schedule, budget, feasibility ... Cost/benefit analysis (CBA) Estimate project development costs Estimate operational costs after project Estimate financial benefits based on annual savings and increased revenues Calculate CBA using ... Systems Analysis and Design in a Changing World, 3rd Edition 23 Confirming Project Feasibility Economic Cost/benefit analysis Sources of funds (cash flow, long-term capital) Organizational and Cultural...

Ngày tải lên: 24/10/2014, 15:36

... ATGGGGTATTTGAGGGTCAG TACCCTCCTTGCGCTCAATC GCGATTCCTTTTGGAGAAGAC TCGATATCCACATCGTCAGC CCGTCGTGGAGACGTCAA CGAGGAGAGGACACAAAGCT TCCACAACTGCTTCCTGATG CACACGACTCAATGCGTACC Subsequently, cDNA was amplified ... zebrafish embryos among scientists (Figure 1. 2A) as well as legislators: The International Organization for Standardization (ISO) has standardized the zebrafish embryo test for waste water quality ... contributed to the dramatic boost in the distance that larvae moved in the dark Larvae responded to the onset of darkness with a strong startle, causing a maximal peak on the speed actogram, then their...

Ngày tải lên: 15/05/2015, 00:37

Ngày tải lên: 16/02/2016, 09:13