... affordable housing programs mainly in Latin America and Asia • Over 27,000 families have benefitted from affordable housing schemes A model affordable home being constructed in Nagarote, Nicaragua ... waste as an alternative fuel provides a benefit to Holcim and society © Holcim Ltd 2010 Population growth and urbanization will increase demand for construction materials • World population to increase ... than 1990 benchmark by 2015 © Holcim Ltd 2010 Drivers of CO2 performance • Lower clinker factor • Use of alternative fuels • New cement capacity with best available technology The use of waste...
Ngày tải lên: 26/07/2014, 21:43
... Acknowledgments The author thanks Herbert Wilf and Janet Beissinger, who was the first to explore [1] combinatorial proofs using colored permutations, for their assistance References [1] Janet Beissinger ... Colorful proofs of generating function identities Unpublished notes, 1981 [2] Richard P Stanley Enumerative combinatorics Vol 1, volume 49 of Cambridge Studies in Advanced Mathematics Cambridge ... Mathematics Cambridge University Press, Cambridge, 1997 With a foreword by Gian-Carlo Rota, Corrected reprint of the 1986 original the electronic journal of combinatorics 17 (2010), #N2 ...
Ngày tải lên: 08/08/2014, 01:20
a translation quality assessment of the first three chapters of the novel the da vinci code by do thu ha (2005) based on j.house's model = đánh giá chất lượng bản dịch ba chương đầu tiên trong cuốn tiểu thuyết
... clearly each element and the way to compare the two texts Regarding the evaluation of the translation, it is said that a good translation insists the equivalence to the ST Translation is the ... methodology - Qualitative method: This research is a qualitative evaluation; hence, the source of data is document, and information is gathered by an analysis of documents and materials Data are categorized ... model to evaluate the Persian translation of William Faulkners The Sound and the Fury. The conclusion drawn was that the translator wrongly translated some parts of the deemed sentences while the...
Ngày tải lên: 02/03/2015, 14:22
A translation quality assessment of the first three chapters of the novel “the da vinci code” by do thu ha (2005) based on j.house’s model
... and to totally convey the interpersonal and ideational features of the ST II Limitations of the study In spite of all that, there are several limitations of the study As stated in the introductory ... (breaches of the target language system, cases of dubious acceptability and mistakes in the denotative meanings of ST) It is stated that the TT has failed to meet the assessor‘s expectations and ... several cases, the TT leaves out certain parts in the ST, hence making the meaning of the TT less clear than that of the ST and breaching the consultative and casual style level of the ST For example:...
Ngày tải lên: 10/08/2015, 19:48
A translation quality assessment of the first three chapters of the novel The da Vinci code by Do Thu Ha (2005) based on J.House's model
... of data is document, and information is gathered by an analysis of documents and materials Data are categorized into patterns as the primary basis for organizing and reporting results Qualitative ... the features of the source text (ST) in the light of Halliday’s functional grammar and House’s dimensions and (2) assessing the level of quality that the translation text reaches Due to the fact ... objectives stated above, this paper needs to answer the following research questions: What are the features of the ST in the light of Halliday’s functional grammar and House’s dimensions? To what degree...
Ngày tải lên: 10/08/2015, 19:48
Báo cáo hóa học: "Research Article A Fixed Point Approach to the Stability of a Functional Equation of the Spiral of Theodorus" pptx
... Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, vol 62, no 1, pp 23–130, 2000 12 S.-M Jung and P K Sahoo, “Stability of a functional equation ... Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, Fla, USA, 2001 G L Forti, “Hyers-Ulam stability of functional equations in several variables,” ... transformations,” Bulletin of the American Mathematical Society, vol 57, pp 223–237, 1951 Th M Rassias, “On the stability of the linear mapping in Banach spaces,” Proceedings of the American Mathematical...
Ngày tải lên: 22/06/2014, 11:20
So, you want to go to grad school in Economics? A practical guide of the first years (for outsiders) from insiders pptx
... program, chances are you are familiar a great deal of the material If not, now it’s the time to learn it well Take your time to so; it’s not a race against time or your classmates to see who can ... other programs Both cooperation and camaraderie is the key Form a study group with students who are at the same level as you are In this way you can work together and learn the material together, ... time to relax, but also to chat with professors and other students and at least share some of the pain you are suffering in the first year Besides the professors, the TA’s of the courses you are...
Ngày tải lên: 08/03/2014, 05:20
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh
... memorization of conversations In fact, speaking activities in a traditional classroom often take place, in the way of one person asking a question and another giving an answer As a result, the questions ... students are highly motivated They are eager to speak because they are interested in the topic and they have something new to say about it or because they want to contribute to achieve a task objective ... tend to use mother tongue if they are grouped with those having the same language, and particularly talking in small groups because they find it easier and more natural to speak their mother tongue...
Ngày tải lên: 15/03/2014, 10:03
Báo cáo khoa học: Contributions to catalysis and potential interactions of the three catalytic domains in a contiguous trimeric creatine kinase doc
... reverse CCC AGG TTG AAT AGT GAA CAG ACG GGC TGG CTC AGG CAG TCT CCT ATG TTC AGA TGG GCC TTC GCC TCC GG GTC CTG ATC CTG CTC CTA CCC GGG CCC GGG CCC GGG CAG GAC CAG GAT TAG GAG TAA GTG CAA GTC CAA GTC ... Ex Taq HS polymerase (Takara USA, Santa Ana, CA, USA) was performed to fill in the sticky ends and add adenine nucleotide overhangs before ligating the individual domains into the TOPO vectors ... acetate was added to a concentration of mm above the concentration of ADP to ensure full saturation of ADP by Mg2+ Assay buffer (100 mm Na-HEPES, pH 7) was added to each mL cuvette to bring the...
Ngày tải lên: 16/03/2014, 06:20
A Perception-Based View of the Employee: A Study of Employees’ Reactions to Change doc
... resistance to change is always undesirable and negative On the other hand, it is probable that resistance to change may at times have a positive effect on the outcome of organizational change, and ... regard to relevant environments, and legal and other barriers to entry or exit from the market may also restrict the nature and degree of organizational change or adaptation in organizations (Hannan ... that a manager as well as an employee, as an agent of a firm, should arrive at a decision that will achieve the firm’s goals, one of which is the maximization of the firm’s value This observation...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: Increased sensitivity of glycogen synthesis to phosphorylase-a and impaired expression of the glycogen-targeting protein R6 in hepatocytes from insulin-resistant Zucker fa ⁄ fa rats pptx
... Zucker fa ⁄ fa rat 1990 Results High activities of glucokinase and phosphorylase in hepatocytes from fa ⁄ fa rats Hepatocytes from fa ⁄ fa rats had a higher total activity of glucokinase (Fa ⁄ ? ... from fa ⁄ fa than Fa ⁄ ? rats and also that there is a rightward shift in the plots of glycogen synthesis against phosphorylase -a or glycogen synthase against phosphorylase -a in fa ⁄ fa compared ... However, the total activity of glycogen synthase and the activation state are the same as in control hepatocytes [6,11] In this study, we used three approaches to modulate the concentration and activity...
Ngày tải lên: 30/03/2014, 11:20
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot
... Comparison of structures of AMY2 and other a- amylases (not shown) also gave the impression that AMY2 might accommodate larger parts of the substrate Thus porcine pancreatic a- amylase like TAA had a larger ... domain B) from AMY2 (in green) and TAA (in black) The superimpositioning was guided by the catalytic acids (D179AMY2, E204AMY2, and D289AMY2 and D206TAA, E230TAA, and D297TAA) The invariant Y51AMY2 ... complexes of inhibitory substrate analogues derived from acarbose and barley a- amylase (AMY2 [16]); and Taka-amylase A (TAA [17]) (A) Stereo view of interactions involving segments of ba loops and...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo hóa học: " Research Article Stability of a Quadratic Functional Equation in the Spaces of Generalized Functions" docx
... domains, and applied the result to the study of an interesting asymptotic behavior of the quadratic functions As a matter of fact, we reformulate 1.1 and related inequality in the spaces of generalized ... functional equation in the domain of distributions,” Aequationes ¨ Mathematicae, vol 3, pp 236–246, 1969 E L Koh, The Cauchy functional equations in distributions,” Proceedings of the American Mathematical ... functional equation, ” Proceedings of the National Academy of Sciences of the United States of America, vol 27, no 4, pp 222–224, 1941 D H Hyers, G Isac, and Th M Rassias, Stability of Functional Equations...
Ngày tải lên: 22/06/2014, 02:20
Báo cáo hóa học: " Research Article Optimum Detection of Ultrasonic Echoes Applied to the Analysis of the First Layer of a Restored Dome" pot
... control of the work The study was made on a : scale model of the actual dome to overcome the problems of accessibility and the danger of damaging paintings A photograph of the : scale model is shown ... (separation between two consecutive locations was cm) crossed some areas where modifications had been made to the surface (a special type of paper was attached to the wall after preparation of the ... that prior knowledge of the actual dome The interest for the restorer is to have information about the state of the layers in some specific areas of the domes; in this particular case to know the...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: "ON BASIN OF ZERO-SOLUTIONS TO A SEMILINEAR PARABOLIC EQUATION WITH ORNSTEIN-UHLENBECK OPERATOR" potx
... Logarithmic Sobolev inequalities, American Journal of Mathematics 97 (1975), no 4, 1061–1083 [8] A A Samarskii, V A Galaktionov, S P Kurdyumov, and A P Mikhailov, Blow-Up in Quasilinear Parabolic ... Parabolic Equations, De Gruyter Expositions in Mathematics, vol 19, Walter de Gruyter, Berlin, 1995 Yasuhiro Fujita: Department of Mathematics, Toyama University, Toyama 930-8555, Japan E-mail address: ... operator The contents of the paper are organized as follows: in Section 2, we state existence and uniqueness of a classical solution to (1.1) In Section 3, we derive Lq -estimates of the classical...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo lâm nghiệp: "Energy consumption of a chipper coupled to a universal wheel skidder in the process of chipping wood" pptx
... was supplied by the motor during caracole and by the rotor in consequence of the revolution decrease The torque of the rotor consists of the disc torque, shaft torque and cardan shaft torque The ... The power varies from kW to 47 kW (these maximum values are calculated from the measurement record) ANOVA (multifactor analysis of variance) was used for finding out the interaction of several ... β Very important is also the value of overhang from the plane of the disc in the process of step on the disc and work with a gradual change of the radius for the cutting edge of the knife Knives...
Ngày tải lên: 07/08/2014, 10:21
Báo cáo khoa hoc:" Prediction of the response to a selection for canalisation of a continuous trait in animal breeding" pps
... variance given the performances of all the ,i d Y of a animals is where us and vs are parts of equation (42), and Cs are submatrices of equation (44) Note that all the individuals in the analysis ... and their expressions as ratios of a covariance to a variance indicate that they can also be obtained from a linear approximation This comment makes it possible to extend easily the approximate ... of parents d and offsprings are related via A d It can be shown that the conditional expectation of a performance future offspring of some animal i of the parent population is equal to and the...
Ngày tải lên: 09/08/2014, 18:21
Báo cáo y học: "A cross-sectional study of the number and frequency of terms used to refer to knowledge translation in a body of health literature in 2006: a Tower of Babel?" pps
... clinician educational material Each article in the database was classified as being about KT or not about KT An example of a KT paper is one by Shojana and colleagues [17] They discuss their thoughts ... population up to 60 years of age, the general population over 60 years of age, and the relatives of patients who died after euthanasia or assisted suicide Their article is a KT article and also categorized ... chose to look at only the titles and abstracts of these articles for two reasons First, titles and abstracts are the tools that authors provide and the indexers of bibliographic databases (such as...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... photographed NAD+ measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... AGCTTACTCATATCGATTTCATACGACTT 1172 BUD6F CAGACCGAACTCGGTGATTT 1173 BUD6R TTTTAGCGGGCTGAGACCTA 1163 HSP12F AAGGTCGCTGGTAAGGTTCA 1164 HSP12R GCTTGGTCTGCCAAAGATTC 1244 PNC1F TTGTGGTCACCAGAGATTGG...
Ngày tải lên: 14/08/2014, 21:20