receptors g protein alpha subunits and phospholipase c b3 expression in p uaec vs np uaec

Curcumin modulates dopaminergic receptor, CREB and phospholipase c gene expression in the cerebral cortex and cerebellum of streptozotocin induced diabetic rats potx

Curcumin modulates dopaminergic receptor, CREB and phospholipase c gene expression in the cerebral cortex and cerebellum of streptozotocin induced diabetic rats potx

Ngày tải lên : 10/08/2014, 05:21
... designed to investigate the beneficial effect of curcumin a neuroprotective agent, on impairment in dopaminergic receptors, CREB and phospholipase C in the cerebral cortex and cerebellum of STZ-induced ... and mGlu5 receptors gene expression in the cerebellum of insulin induced hypoglycaemic and streptozotocin induced diabetic rats Eur J Pharmacol 2010, 630:61-68 Puglisi-Allegra S, Cestari V, Cabib ... with CREB is also suggested which needs further studies The effect of curcumin in interacting with the dopaminergic receptor and CREB in STZ-induced diabetes proves its potential in managing CNS...
  • 11
  • 413
  • 0
Báo cáo khóa học: Phospholipase C, protein kinase C, Ca 2+ /calmodulin-dependent protein kinase II, and redox state are involved in epigallocatechin gallate-induced phospholipase D activation in human astroglioma cells ppt

Báo cáo khóa học: Phospholipase C, protein kinase C, Ca 2+ /calmodulin-dependent protein kinase II, and redox state are involved in epigallocatechin gallate-induced phospholipase D activation in human astroglioma cells ppt

Ngày tải lên : 16/03/2014, 16:20
... respect, oxidant-induced PLD activation is comparable to PLD activation via ROS induced by EGCG, suggesting the specificity of the ROS cascade induced by EGCG EGCG increased [Ca2+]i in U87 cells, and ... stimulated PLD activity, and induced inositol phosphate production and [Ca2+]i in astroglioma cells EGCG-induced PLD activation was suppressed by the phosphoinositide-speci c PLC inhibitor PLC -c1 was ... Ca2+-activated protein kinase, CaM kinase II (Fig 9D) These data suggest that EGCG activates PKC-a in U87 cells Involvement of PKC in EGCG-induced PLD activation Discussion Phosphoinositide-specific...
  • 11
  • 279
  • 0
Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Báo cáo khoa học: Activation of nematode G protein GOA-1 by the human muscarinic acetylcholine receptor M2 subtype Functional coupling of G-protein-coupled receptor and G protein originated from evolutionarily distant animals doc

Ngày tải lên : 07/03/2014, 11:20
... template with the following primers: M2-myc-EcoRI-s, 5¢-CAGAATTCatg gagcagaagctgatctccgaggaggacctgctgGTGAACAACTCCAC CAACTCCTCCAACAACTCCCTGGCTCTTACAAGTC CTTATAAGACA-3¢; HsM2-as, 5¢-TTACCTTGTAGCG ... following primers: M2-goa1-s, 5¢-CATTATAAGA ACATAGGCGCTACAAGGATGGGTTGTACCATGTC ACAGGAAG-3¢; M2-goa1-PstI-as, 5¢-CCAATGCATTGG TTCTGCAGTTAATACAAGCCGCATCCACGAAGA-3¢ (An engineered PstI recognition ... Kameyama K, Haga K, Haga T, Moro O & Sadee W (1994) Activation of a GTP-binding protein and a GTPbinding -protein- coupled receptor kinase (beta-adrenergic-receptor kinase-1) by a muscarinic receptor m2...
  • 9
  • 400
  • 0
Báo cáo khoa học: G protein-coupled receptor 30 down-regulates cofactor expression and interferes with the transcriptional activity of glucocorticoid pdf

Báo cáo khoa học: G protein-coupled receptor 30 down-regulates cofactor expression and interferes with the transcriptional activity of glucocorticoid pdf

Ngày tải lên : 16/03/2014, 18:20
... 5¢-TAATAAGTCGACGGGTC TCTTCCT-3¢ and GPR30-reverse 5¢-ATTATTGGATC CTACACGGCACTGC-3¢ Viruses capable of introducing pLEGFP-N1, pLEGFP-N1/GPR30, pL-N1 and pL-N1/ GPR30 vectors were established in the PT67 packaging ... G protein- coupled receptors I Diversity of receptor–ligand interactions J Biol Chem 273, 17299–17302 Brady, A.E & Limbird, L.E (2002) G protein- coupled receptor interacting proteins: emerging ... concentrations of GPR30 (D) COS cells were transfected with a glucocorticoid response element-tk-luc reporter construct, and expression vectors containing glucocorticoid receptor a and GPR30 Luciferase...
  • 10
  • 389
  • 0
g protein signaling, methods and protocols

g protein signaling, methods and protocols

Ngày tải lên : 10/04/2014, 22:24
... GTPase-activating proteins for Gqα and block activation of phospholipase C by γ-thio-GTP-Gqα Proc Natl Acad Sci USA 94, 428–432 22 Chidiac, P and Ross, E M (1999) Phospholipase C- β1 directly accelerates GTP ... glycerol stock using a sterile toothpick to a LB agar plate containing 50 g/ mL kanamycin and 50 g/ mL ampicillin Streak for single colonies and incubate the plate overnight at 37 C Pick a single ... the expression of Giα and Gsα proteins in E coli Protocols are provided for the purification of untagged G protein a subunits using conventional chromatography and histidine (His)-tagged subunits...
  • 233
  • 306
  • 0
Báo cáo y học: "Phospholipase C beta 4 in mouse hepatocytes: Rhythmic expression and cellula" pps

Báo cáo y học: "Phospholipase C beta 4 in mouse hepatocytes: Rhythmic expression and cellula" pps

Ngày tải lên : 13/08/2014, 13:20
... bp) and plcβ4 set B forward (AAGACGCACGCGATTGAGTTTGTA) and reverse (CCACGTATGTCCCGATCTTCTTAT) amplified a 355 bp segment (1943–2297 bp) gapdh mRNA was amplified using forward (GAGCGAGACCCCACTAACATCAAA) ... isolated using two primer sets that amplified overlapping regions of similar size plcβ4 set A forward (GCAGGTTATATCAGGGCAGTTCC) and reverse (TTGTTGGCAGTGATAATGGTTTGT) amplified a 326 bp segment (2246–2570 ... (GAGCGAGACCCCACTAACATCAAA) and reverse (GAGGGGCCATCCACAGTCTTCT) primers that selected for a 341 bp segment (279–619 bp) Primers were designed using the DNA Star program (Laser Gene) and NCBI published sequences...
  • 9
  • 274
  • 0
Báo cáo khoa học: NBR1 interacts with fasciculation and elongation protein zeta-1 (FEZ1) and calcium and integrin binding protein (CIB) and shows developmentally restricted expression in the neural tube pptx

Báo cáo khoa học: NBR1 interacts with fasciculation and elongation protein zeta-1 (FEZ1) and calcium and integrin binding protein (CIB) and shows developmentally restricted expression in the neural tube pptx

Ngày tải lên : 08/03/2014, 10:20
... scanning confocal microscope (Zeiss) RESULTS NBR1 interacts with the PKC zeta interacting protein FEZ1 and the calcium and integrin binding protein CIB In order to identify proteins that interact with ... subcloned into the pEGFP-N2 expression vector (Clontech) to produce a C- terminal EGFP tagged construct (pFEZ1-EGFP) The full-length NBR1 cDNA was subcloned into the pHM6 expression vector (Roche) ... (iii) pGBT9NBR1333 (iv) pGBT9NBR 1C term (v) pGBT9NBR 1c1 (vi) pGBT9NBR 1c2 (vii) pGBT9NBR 1c3 , viii) pGBT9NBR 1c4 or (ix) pGBKT7CIB and tested for protein protein interaction by a colony lift b-galactosidase...
  • 8
  • 421
  • 0
Báo cáo khoa học: Interaction of an  40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf

Báo cáo khoa học: Interaction of an  40 kDa protein from regenerating rat liver with the )148 to )124 region of c-jun complexed with RLjunRP coincides with enhanced c-jun expression in proliferating rat liver pdf

Ngày tải lên : 16/03/2014, 18:20
... excluding Triton X-100) in the presence of nonspeci c DNA in 1· binding buffer excluding Triton X-100 The proteins bound specifically to Jun-25 were eluted with binding buffer containing increasing ... to minor groove binding drugs, actinomycin D and distamycin A, confirms that these are minor groove binding proteins rRLjunRP is an  40 kDa protein that interacts with the RLjunRP–Jun-25 adduct ... larger protein complex in regenerating liver bound to the target site An increase in the C1 complex formation can also be seen h after partial hepatectomy, indicating increased RLjunRP concentrations...
  • 11
  • 438
  • 0
Báo cáo khoa học: ISC1-encoded inositol phosphosphingolipid phospholipase C is involved in Na+/Li+ halotolerance of Saccharomyces cerevisiae pptx

Báo cáo khoa học: ISC1-encoded inositol phosphosphingolipid phospholipase C is involved in Na+/Li+ halotolerance of Saccharomyces cerevisiae pptx

Ngày tải lên : 31/03/2014, 09:20
... Biochem 269) phosphatase calcineurin [23–25] The target protein of calcineurin action in yeast is the zinc-finger transcription factor Crz 1p [38,39] Crz 1p dephosphorylation initiates its nuclear ... For instance, raising the intracellular Ca2+ level is expected to stimulate calcineurin activity and, thus, ENA1 expression In mammalian cells various glycerophosphoinositide-speci c phospholipases ... Salt-stress-dependent induction of ENA1 involves the Ca2+/calmodulin-activated protein phosphatase calcineurin [25], the TOR-GLN3 signalling pathway [27] and possibly also an additional, calcineurin-independent...
  • 7
  • 239
  • 0
Báo cáo khoa học: "Immunohistochemical detection of Prion protein (PrP-Sc) and epidemiological study of BSE in Korea" pot

Báo cáo khoa học: "Immunohistochemical detection of Prion protein (PrP-Sc) and epidemiological study of BSE in Korea" pot

Ngày tải lên : 07/08/2014, 14:23
... or neuropil was seen in H&E staining, PrP-Sc was detected in IHC However, many areas containing PrP-Sc showed no vacuolation PrP-Sc antigen accumulated within brain stem nuclei with spongiform ... Tonsillar biopsy and PrPSc detection in the preclinical diagnosis of scrapie Vet Rec 1998, 142, 564-568 Immunohistochemical detection of Prion protein (PrP-Sc) and epidemiological study of BSE in Korea ... 1997, 407, 1-6 McGill, I S and Wells, G A H Neuropathological findings in cattle with clinically suspect but histologically unconfirmed bovine spongiform encephalopathy (BSE) J Comp Pathol 1993,...
  • 7
  • 266
  • 0
Báo cáo y học: "Strong inhibition of TNF-α production and inhibition of IL-8 and COX-2 mRNA expression in monocyte-derived macrophages by RWJ 67657, a p38 mitogen-activated protein kinase (MAPK) inhibitor" ppt

Báo cáo y học: "Strong inhibition of TNF-α production and inhibition of IL-8 and COX-2 mRNA expression in monocyte-derived macrophages by RWJ 67657, a p38 mitogen-activated protein kinase (MAPK) inhibitor" ppt

Ngày tải lên : 09/08/2014, 01:23
... factors such as activating transcription factor (ATF)-2 and cyclic AMP response element binding protein (CREB) Our results indicate an important role for p3 8 MAPK in COX-2 mRNA expression in ... City, CA, USA) Specific antibodies to p3 8 MAPK, phospho -p3 8 MAPK, and phospho-MAPKAPK-2 were purchased from Cell Signalling Technologies (Beverly, MA, USA) and detecting antibody peroxidaseswine-anti-rabbit ... 274:264-269 Caivano M, Cohen P: Role of mitogen-activated protein kinase cascades in mediating lipopolysaccharide-stimulated induction of cyclooxygenase-2 and IL-1 beta in RAW264 macrophages J Immunol...
  • 9
  • 317
  • 0
báo cáo khoa học: " Antitumor activity of mixed heat shock protein/ peptide vaccine and cyclophosphamide plus interleukin-12 in mice sarcoma" pot

báo cáo khoa học: " Antitumor activity of mixed heat shock protein/ peptide vaccine and cyclophosphamide plus interleukin-12 in mice sarcoma" pot

Ngày tải lên : 10/08/2014, 10:21
... antigens unique to an individual Purification of chaperone HSP from a cancer is believed to co-purify an antigenic peptide “fingerprint” of the cell of origin [17] Thus, a vaccine comprising HSP/peptide ... antigen-specific Th1 cells and IFNg-producing NK cells, the number of IFN -g- secreting splenocytes was determined by an in vitro assay of IFNgamma ELISPOT The frequency of IFN -g- producing splenocytes ... Eastern Cooperative Oncology Group: A phase II trial of interleukin-12 in patients with advanced cervical cancer: clinical and immunologic correlates Eastern Cooperative Oncology Group study E1E96 Gynecol...
  • 9
  • 326
  • 0
Đồ án bước đầu nghiên cứu ép tách protein từ đầu tôm thẻ trong quá trình sản xuất chitin và bổ sung protein thu hồi được vào chượp trong sản xuất nước mắm

Đồ án bước đầu nghiên cứu ép tách protein từ đầu tôm thẻ trong quá trình sản xuất chitin và bổ sung protein thu hồi được vào chượp trong sản xuất nước mắm

Ngày tải lên : 31/08/2014, 06:50
... =O)7 B{ & ; ppppppppppppppl q%\ y & \ ppppppppp i B{ & =O=7 B{ & H\ & &+% , n ? % -.pppppppppppppppppppppppppppppp ~ B{ & =O B{ & H\ & ? + @ y &+% , { pppppppppppppppppppppppppppppO ~ B{ & =O87 ... ppO8l \ $% " C H%2 ; - &+% , ppppppppppppppppppppppppp8 9C Oi7 &+% , ? \ G% y $% " C H%2 { ppppppppppppppppppppppppppOO*: 9C O~7 ? + @ y - &+% , ppppppppppp*) 9C Ol7 ? + @ y yF z pppppppppppO*= ... ? + - &+% , ppppOO8: - &+% , pppOOO8) y - yF z pppppp8= @ y n yF z ppppppppppppppppppppOOO8= j =O):7 "\ , j =O))7 - pppppppppppppppppppppOOO88 pppppppppppppppppppO88 B{ & =O)=7...
  • 84
  • 550
  • 0
Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

Safe Blood Transfusion- Screening for Hepatitis B and Hepatitis C Virus Infections in Potential Blood Donors in Rural Southeast Asia

Ngày tải lên : 03/03/2015, 21:05
... Sub genotype C1 was predominant in Japan, Korea, China; C2 in China, Southeast Asia and Bangladesh; and C3 composing specifying adrq- [31] Genetic heterogeneity of HBV has clinical significance ... clearance compared to genotype C [38] Escape mutants is also a matter of concern when considering the efficacy of HBV vaccine in a given population Regarding this, efficacy of HBV vaccine depends ... cleavage sites of the HCV poly -protein precursor by the endoplasmic reticulum signal peptidase The open diamond indicates further C- terminal processing of the core protein by signal peptide peptidase...
  • 64
  • 464
  • 0
Báo cáo y học: "Dynamic compression counteracts IL-1β induced inducible nitric oxide synthase and cyclo-oxygenase-2 expression in chondrocyte/agarose constructs" pdf

Báo cáo y học: "Dynamic compression counteracts IL-1β induced inducible nitric oxide synthase and cyclo-oxygenase-2 expression in chondrocyte/agarose constructs" pdf

Ngày tải lên : 09/08/2014, 10:23
... 5'-GTAACAAAGGAGATAGAAACAACAGG-3' Reverse: 5'CAGCTCCGGGCGTCAAAG-3' 81 1.98 ± 0.06 COX-2 AF031698 Probe: 5'-FAM-CGCGATCGTCAGAAATTCGGGTGTGGTACAGTTGATCGCGDABCYL-3' Forward: 5'-CGAGGTGTATGTATGAGTGTAGG-3' ... 5'-CGAGGTGTATGTATGAGTGTAGG-3' Reverse: 5'GTTGGGAGTGGGTTTCAGG-3' 82 1.99 ± 0.03 Aggrecan U76615 Probe: 5'-FAM-CGCGATCCACTCAGCGAGTTGTCAGGTTCTGAGATCGCGDABCYL-3' Forward: 5'-TGGTGTTTGTGACTCTGAGG-3' Reverse: 5'GATGAAGTAGCAGGGGATGG-3' ... 5'GATGAAGTAGCAGGGGATGG-3' 79 1.97 ± 0.05 Collagen type II X02420 Probe: 5'-FAM-CGCGATGCGTCAGGTCAGGTCAGCCATATCGCG-DABCYL-3' Forward: 5'-AAACCCGAACCCAGAACC-3' Reverse: 5'AAGTCCGAACTGTGAGAGG-3' 70 2.00...
  • 13
  • 261
  • 0
báo cáo khoa học: " The SNF1-type serine-threonine protein kinase SAPK4 regulates stress-responsive gene expression in rice" ppsx

báo cáo khoa học: " The SNF1-type serine-threonine protein kinase SAPK4 regulates stress-responsive gene expression in rice" ppsx

Ngày tải lên : 12/08/2014, 05:20
... (LOC_Os0 6g3 7180; primer sequences: 5'-ATTGACAGGCAGCTGCAT-3' and 5'-GCAATGTCCATGCTAGGT-3'), OsCLC1 (LOC_Os0 1g6 5500; primer sequences: 5'-TGTACAAGCAGGACTGGA-3' and 5'-AGATAGGCCTTCACCTCA-3', and catalase ... (LOC_Os0 2g0 2400; primer sequences: 5'-GGATGACACCAAGACATG-3', 5'TCACGTTGAGCCTATTCG-3') Actin was amplified as a loading control (primer sequences: 5'-GTGATCTCCTTGCTCATACG-3' and 5'-GGNACTGGAATGGTNAAGG3') ... 5'-TCATATGCGCAGTGAGCTCAT-3', primers for analyses of transcription: 5'-TGGCTACTCCAAGTCATC-3', 5'-TCGTACTCATCTTCCTCC-3'), OsNHX1 (LOC_Os0 7g4 7100; primer sequences: 5'-ATCTTCAATGCAGGCTTC-3' and 5'TGCATCCATCCCAACATA-3'),...
  • 13
  • 288
  • 0
Báo cáo khoa học: " Effect of a povidone-iodine intrauterine infusion on progesterone levels and endometrial steroid receptor expression in mares" pptx

Báo cáo khoa học: " Effect of a povidone-iodine intrauterine infusion on progesterone levels and endometrial steroid receptor expression in mares" pptx

Ngày tải lên : 12/08/2014, 18:22
... involved in drafting the manuscript and then read and approved the final manuscript Kalpokas et al Acta Veterinaria Scandinavica 2010, 52:66 http://www.actavetscand.com/content/52/1/66 Competing interests ... epithelium, glandular epithelium, stroma), section (sect.: superficial or deep) and their interactions PPC, percentage of positive cells; SI, staining intensity varied among days in most cell types and ... the PR, are critical in preparing the endometrium for pregnancy The increase in progesterone concentrations post-ovulation elicits the proliferation and maximal ERa and PR expression in the luminal...
  • 8
  • 347
  • 0
Báo cáo y học: " Dehydroepiandrosterone administration modulates endothelial and neutrophil adhesion molecule expression in vitro" doc

Báo cáo y học: " Dehydroepiandrosterone administration modulates endothelial and neutrophil adhesion molecule expression in vitro" doc

Ngày tải lên : 13/08/2014, 01:20
... known to influence distinct signal transduction pathways, such as the phosphoinositide 3-kinase (PI3K)/Akt, p3 8 mitogen-activated protein kinase (MAPK) and glycogen synthase kinase (GSK)-3β pathways ... endotoxin (lipopolysaccharide (LPS)) challenge LPS was chosen to mimic a 'septic' state in the cell environment Experiments using DHEA treatment after LPS challenge Page of 10 (page number not for citation ... has no influence itself, and an effect under physiological conditions can thus be speculated to occur Figure Relative CD18 expression levels: *lipopolysaccharide (LPS) significant compared to...
  • 10
  • 190
  • 0
Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis

Regulation of substance p and neurokinin 1 receptor expression in a mouse model of acute pancreatitis

Ngày tải lên : 09/09/2015, 17:54
... TTCCAGCCCCTCATAATCAC-3’ PPTA Sense: (NM_009311) Antisense: 5’- GCTTGGACAGCTCCTTCATC-3’ NEP Sense: (NM_008604.3) Antisense: 5’- GCAAAAGCCGCTTCCACATA-3’ (GenBank Accession No.) 5’- TGTTACCAACTGGGACGACA-3’ ... CACTGTCCTCATTCTCTTGTGGG-3’ Annealing: 57.5 C PPTA Sense: 36 cycles (NM_009311) Antisense: 5’- GCTTGGACAGCTCCTTCATC-3’ 5’- CTTGCCTTTTGGAACCGTGTG-3’ 5’- CGCGATGCAGAACTACGAAA-3’ 501 282 Annealing: 57.5 C 2.2.8 ... three genes in mammals, namely preprotachykinin A (PPTA), preprotachykinin B (PPTB), and preprotachykinin C (PPTC) The preprotachykinin gene encodes long precursor proteins, which are then cleaved...
  • 190
  • 432
  • 0

Xem thêm