quot value sensitive design quot a synthetic approach to technological development
Báo cáo y học: " Control of allergic rhinitis and asthma test – a formal approach to the development of a measuring tool" ppt
... Formal Consensus Process Ana Arrobas Ana Todo-Bom Ângela Gaspar Aurora Carvalho Carlos Alves Carlos Lopes Fernando Calvário Authors' contributions LNS participated in data collection, analysis and ... Inácio Filomena Falcão Gra a Castelo-Branco Jaime Correia-Sousa João Almeida Fonseca José Costa Trindade José Dias-Pereira José Moreira-Silva Additional material Josefina Rodrigues Additional file ... the manuscript draft, SVM participated in data collection and analysis and reviewed the manuscript, RCC participated in study design, web application design, data analysis and reviewed the manuscript;...
- 9
- 370
- 0
Báo cáo y học: "A genomic approach to investigate developmental cell death in woody tissues of Populus trees" pot
... POPLAR.11658, AATCCCATGAATATTACCCCTAGA and TCTCTTGCATGGGTAGACATTTT for POPLAR.11639, ACCTCCATAGCCACCCAAG and CTGCAAGCTGATGCAGAAGT for POPLAR.11646, TGAACAGCAGGAGGTGTGAG and AACAGGTGTCCCCATCTGAG ... POPLAR.11624, and TGGCAACTCCAATGAAGAAC and CACCAACAGTTTATTTATTATTCAGATG for POPLAR.9335 Analysis of proteases in the POPULUSDB A list of Populus proteases was compiled, based on known protease ... gene-specific primers and the 18S competimers (Ambion) The gene-specific primers were ACAGATGAAGCGTTCAGCAA and CAGTGCAGCACACCTAGGAA for cluster POPLAR.11628, CAGGAAAGCTCTCCGTTTCTT and TCAAAGCTCTTCCCTTCTGC...
- 14
- 299
- 0
MDA: A Formal Approach to Game Design and Game Research ppt
... iterative approach to design and tuning It allows us to reason explicitly about particular design goals, and to anticipate how changes will impact each aspect of the framework and the resulting designs/implementations ... “fun” and “gameplay” towards a more directed vocabulary This includes but is not limited to the taxonomy listed here: Sensation Game as sense-pleasure Fantasy Game as make-believe Narrative Game as ... than media By this we mean that the content of a game is its behavior – not the media that streams out of it towards the player Thinking about games as designed artifacts helps frame them as...
- 5
- 630
- 0
Site Analysis: A Contextual Approach to Sustainable Land Planning and Site Design
... greater mapping accuracy & Changes in the database are immediately reflected in digital maps & Spatial analysis Digital spatial data are available in two forms: raster or vector Raster data are grid-cell ... SYSTEMS (GIS) A GIS consists of computer hardware and software, data on locations and attributes, and data about the data—or metadata Rapid advances in computer hardware and software have vastly improved ... web site at www.wiley.com Library of Congress Cataloging-in-Publication Data: LaGro, James A Site analysis : a contextual approach to sustainable land planning and site design / James A LaGro, Jr.—2nd...
- 386
- 475
- 0
Báo cáo hóa học: "Research Article A Novel Approach to the Design of Oversampling Low-Delay Complex-Modulated Filter Bank Pairs" doc
... that the tolerance mask is not always touched by the magnitude response In some regions the magnitude response ranges far below the allowed attenuation, which can be traced back to the fact that ... yield a convex optimization problem 3.2.1 Passband Narrow-band low-pass filters usually not exhibit a distinctive passband In order to obtain a narrowband low-pass filters it is sufficient to ask for ... delay yields a smoothing effect In the stopband the group delay is apparently not minimized at all Therefore the stopband can be regarded as a “do not care” region thus increasing the available degrees...
- 13
- 623
- 0
Báo cáo hóa học: " Research Article A Systematic Approach to Design Low-Power Video Codec Cores" doc
... vector q for the EURASIP Journal on Embedded Systems Full Op mode Addr Data in Data out Block Block ··· Block n − Data Data Data Data Data Data Data Data ··· ··· ··· ··· Data k − Data k − Data ... edges are relaxed: partial releases are added to the typically random accessible data in the container of a token These partial releases enable releasing only a part of the acquired tokes to support ... Yokohama, Japan, January 2006 F Haim, M Sen, D.-I Ko, S S Bhattacharyya, and W Wolf, “Mapping multimedia applications onto configurable hardware with parameterized cyclo-static dataflow graphs,”...
- 14
- 441
- 0
Báo cáo khoa học: "Veterinary decision making in relation to metritis - a qualitative approach to understand the background for variation and bias in veterinary medical records"
... able to create meaningful data valid in large scale analyses (across herds and veterinary practices) Such veterinarians would generally want to focus on possibilities for across-herd data analyses ... scores as a 'diagnostic tool' related to each individual treatment decision rather than being part of a collaborative data collection For example, they could add rectal temperature and other parameters ... Page of 10 (page number not for citation purposes) Acta Veterinaria Scandinavica 2009, 51:36 cal analyses in the future, and they are highly motivated to use, for instance, multi-factorial analysis...
- 10
- 587
- 0
Báo cáo y học: " A Practical Approach to Managing Patients with HCV Infection"
... correlates poorly with liver histology, the ratio of aspartate aminotransferase (AST) to alanine aminotransferase (ALT) >1 is a dependable marker for cirrhosis [28,29] Increased INR and thrombocytopenia ... decompensation, development of HCC, and mortality In addition, HCV infection has been linked to a variety of extra-hepatic manifestations such as autoimmune diseases, lymphoma, monoclonal gammopathies and ... regardless of treatment candidacy Alcohol abstinence should be recommended to all patients as this may accelerate the progression of liver disease Hepatotoxic drugs should also be avoided, as patients...
- 6
- 532
- 0
Báo cáo y học: "A Practical Approach to Management of Chronic Hepatitis B"
... years, ALT has been used as a standard surrogate for the activity of CHB Thus, ALT level in combination with HBV DNA level and histological activity has been used as a determinant for HBV treatment ... normal transaminases have historically not been considered as candidates for HBV treatment based on the assumption that these patients usually have a slow progression and evidence that these patients ... predictors of response to LAM and ADV therapies are similar to those for IFN except that baseline HBV DNA may not be very important Individualization of HBV Treatment As summarized in Table and...
- 7
- 541
- 0
A New Approach to Quantum Theory
... However, Feynman soon learned that there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by ... xn (a) and which leaves the action invariant (for example, the transformation may be a rotation) The transformation is to contain a parameter, a, and is to be a continuous function of a For a equal ... gives probably the most fundacorresponds to e mental quantum analogue for the classical Lagrangian function It is preferable for the sake of analogy to consider the classical Lagrangian as a function...
- 142
- 574
- 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents
... time available/ in the available time.(1) We have to exploit all available potential/ all potential available in our country (2) As we know that when changing the position of adjective available ... should be washed everyday Nguyễn Thị Nga K 1 1A 19 Graduation paper 2.2.5 Exclamatory adjective sentence An adjective as head of an adjective phrase or as its sole realization can be an exclamation: ... up to now C .A plays an important role in learning a foreign language as a main subject at most language universals According to C James (1980;19), C .A is a form of inter-language study and a central...
- 44
- 1,746
- 7
Listening to Patients A Phenomenological Approach to Nursing Research and Practice
... the American Nurses Association, the American Psychological Association, and Sigma Theta Tau International She is a board member of the International Council on Women's Health Issues and a charter ... Library of Congress Cataloging-in-Publkation Data Thomas, Sandra P, Listening to patients : a phenomenological approach to nursing / Sandra P Thomas, Howard R Pollio p cm Includes bibliographical ... the man as a nurse and Ginger as a physician, whereas still other reactions identify the man as a nurse and Ginger as a patient You don't have to be a philosopher of language or a communications...
- 309
- 398
- 0
Managing and Practicing OD in an IT Environment - A Structured Approach to Developing IT Project Teams
... team The database analysts and the programmers are unable to agree on the proper ways to pass information back and forth between the interface and the database, and the requirements analysts and ... software packages), hardware and software implementation (implementing new computers or software), database management and revision (ensuring proper data storage and access), hardware and software ... Project managers usually employ a Responsibility Assignment Matrix (RAM) such as the sample in Table (PMI, 2000), and OD scholars have advocated similar approaches in teambuilding and organizational...
- 33
- 566
- 0
College writing - A personal approach to academic writing
... into manageable size—say to make a presentation about the Vietnam War or locate the best marketing strategy for a hypothetical business venture—consider making a quick visual map to see what ... number of audiences equals the number of students in class Write one per slip of paper and place in a hat and let each student draw an audience out of a hat Each now write a paragraph to the audience ... makes a permanent record to be reread and studied in your absence And if you want to maintain a certain tone or coolness of demeanor, this can be accomplished more easily in writing than in face-toface...
- 253
- 494
- 0
Tài liệu The New Face oF GoverNmeNT: How Public Managers Are Forging a New Approach to Governance pdf
... the Sandia National Laboratory study on enterprise transformation serves to bring the dangers that managers and administrators face when attempting to impose a transformational change into their ... Sandia National Laboratories approach, a four-level transformation model that focuses on identifying a transformation trigger, and an eight-factor public management model A Need for Transformation ... the earlier actions are integrated into the organization’s culture The Sandia Laboratories management team, for example, warned that a transformation initiative should not demand more than the...
- 288
- 2,415
- 0
Tài liệu A Strategic Approach to Cost Reduction in Banking - Achieving High Performance in Uncertain Times docx
... competitive advantage over its rival and is on the path to high performance The key is for banks to evaluate their business model now against scenarios ranging from best case to worst case, and to act ... program initiatives1 As Figure shows, a tactical cost-cutting approach will quickly yield substantial savings which rapidly level off after the first year A bank taking a more strategic, transformational ... Accenture’s approach to efficiency contains a portfolio of tools and assets—the Accenture High Performance Bank Framework—that can help a bank achieve high performance We believe there are significant...
- 16
- 508
- 0
Tài liệu CHAPTER TwENTY ONE A BIOLOGICAL APPROACH TO A MODEL OF AESTHETIC ExPERIENCE OSHIN VARTANIAN AND MARcos NADAL pdf
... orbital frontal cortex was greater for stimuli classified as beautiful, and the authors argued that this activation in the orbital frontal cortex was due to the reward value of beautiful paintings ... contrast, the studies by Kawabata and Zeki (2004) and Skov ef al (2005) attempted to isolate those cortical structures that are actIvated more when a stimulus is evaluated as beautiful Presumably, ... neural correlates of preference and beauty, two variables that have affective and cognitive components The areas activated by Vartanian and Goel (2004b) may have highlighted those cOrlical structures...
- 9
- 598
- 0
Tài liệu Báo cáo khoa học: "A Bootstrapping Approach to Named Entity Classification Using Successive Learners" pdf
... words, the availability of an almost unlimited raw corpus compensates for the modest recall As a result, large quantities of NE instances are automatically acquired An automatically annotated NE ... limited recall Then, these rules are applied to a large raw corpus to automatically generate a tagged corpus Finally, an HMM-based NE tagger is trained using this corpus There is no iterative learning ... fourDigitNum, containsDigitAndAlpha, containsDigitAndDash, containsDigitAndSlash, containsDigitAndComma, containsDigitAndPeriod, otherNum, allCaps, capPeriod, initCap, lowerCase, other Benchmarking and Discussion...
- 8
- 489
- 0
Tài liệu A structured approach to Enterprise Risk Management (ERM) and the requirements of ISO 31000 ppt
... identify critical components that are key to success G HAZOP and FMEA approaches Hazard and Operability studies and Failure Modes Effects Analysis are quantitative technical failure analysis techniques ... N 17 Risk appetite, tolerance and constraints Sources of assurance available to the Board A structured approach to Enterprise Risk Management Appendix B: Implementation summar y The table below ... structured approach to Enterprise Risk Management Risk management framework Depending on the nature of the organisation, the risk management function may range from a part-time risk manager, to a single...
- 20
- 818
- 1
Tài liệu Báo cáo khoa học: "A PRAGMATICBASED APPROACH TO UNDERSTANDING" pdf
... a Natural Language Interface to Complex Data", SRI International, 1976 hltman,D.J., and Allen, J.F., "A Plan Recognation Model for Clarification Subdlalogues", Proceedings of the International ... exlsting plan may contain constant instantiatlons in place of former variaOles A term fragment still associates with such constant terms A constant fragment can only associate with terms whose semantic ... utterance Allen views the speaker's utterance as part of a plan which the speaker has constructed and is executlug to accomplish his overall task-related goals To interpret elliptical fragments, Allen...
- 10
- 446
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn hệ số công suất cosp fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu chỉ tiêu chất lượng 9 tr 25