quickly create a text copy of emails

Mac Kung Fu pot

Mac Kung Fu pot

... Programmers, LLC was aware of a trademark claim, the designations have been printed in initial capital letters or in all capitals The Pragmatic Starter Kit, The Pragmatic Programmer, Pragmatic ... Trackpad When a Mouse Is Attached Install Only Printer Drivers and Not Their Add-ins Send Somebody a Link to an App Get a Bigger Search Area in Safari Copy Calculator Results Bookmark Images and ... Notes Create a Quit All App Upgrade Your Computer’s RAM Start GUI Apps from the Command Line Quickly Create a Text Copy of Emails Search Spotlight from a Terminal Window Enable the Root User Wake...

Ngày tải lên: 06/03/2014, 20:20

318 5,6K 0
Infelicities of the Intended Meaning of Canonical Texts and Norms Constraining Interpretation

Infelicities of the Intended Meaning of Canonical Texts and Norms Constraining Interpretation

... nothing – and what our norm regarding voting provides is the case, namely, that a law was passed If we say that because of the mistaken and pivotal aye vote a law was passed but it has no applications, ... in favor of a law and its language but against all possible meanings of that language Consider this stylized representative case Rule makers A, B, and C vote on term T T is vague and can mean ... it One way to handle such cases of failed law is to bite the bullet and say that, despite appearances to the contrary, those legal texts are not laws They are only apparent laws Alternatively,...

Ngày tải lên: 01/11/2013, 08:20

24 443 0
A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK

A STUDY ON IMPROVING ENGLISH SPEAKING SKILLS TO 10TH FORM MINORITY STUDENTS AT GIA PHU HIGH SCHOOL IN THE NEW SET OF ENGLISH TEXTBOOK

... sort of proficiency learners need Teaching a second language used to be aimed at enabling learners to read and appreciate class of literature Therefore, any teacher who was able to reach this aim ... knows a foreign language can speak that language Pattison (1992) confirms that when a person speaks of knowing or learning a language they mean being able to speak the language Oral communication ... teachers understand their aims For example, it is obvious that in order to be able to speak a foreign language, it is necessary to know a certain amount of grammar and vocabulary Part of a language...

Ngày tải lên: 29/01/2014, 10:33

44 1,5K 1
the events leading up to the international style of architecture being used in america

the events leading up to the international style of architecture being used in america

... shaped frame made of steel It became the symbol for the elegance of the avante-garde lifestyle Today, this piece of furniture is still as captivating as it was at its debut A similar piece of ... debut at the 1929 International Exhibition in Barcelona, Spain (Barcelona chair) (Brno Flat Chair) The Barcelona chair is a wide armless chair with leather quilted cushions, sitting atop a double ... one of the purest forms of Modernism It holds to geometric designs with flat roofs and uniform arrangement of windows The materials are steel, iron and metal, making it affordable and malleable...

Ngày tải lên: 21/03/2014, 22:54

2 304 0
Báo cáo lâm nghiệp: "Changes in the mycorrhizal status of some mountain spruce forests" potx

Báo cáo lâm nghiệp: "Changes in the mycorrhizal status of some mountain spruce forests" potx

... correlation coefficients for all variable couples Basic calculations and graphs were created in the programme Microsoft Excel For further processing of data, various modules of Statistica 6.0 (StatSoft ... precipitation, summer precipitation, average annual and summer temperature (from April to September) In the matrix of these variables the basic statistical values were calculated and the correlations ... influence of weather oscillation from year to year cannot be fully eliminated Density of active mycorrhizae (AM, calculated as average values of spring – autumn) varied from 0.55 (Růžová hora 2006)...

Ngày tải lên: 07/08/2014, 03:22

7 374 0
Bài thuyết trình bằng tiếng anh về Phong cách thời trang quý tộc của nữ hoàng Elizabeth đệ nhị  THE IMPECCABLE STYLE OF  QUEEN ELIZABETH II

Bài thuyết trình bằng tiếng anh về Phong cách thời trang quý tộc của nữ hoàng Elizabeth đệ nhị THE IMPECCABLE STYLE OF QUEEN ELIZABETH II

... always been regarded as one of the prominent face of the world with style Royal dramatic fashion since she was a teenager until today, when at the age of 87 5/12/15 American Headway • As a child ... Princess Elizabeth sat at the table reading a book in her 1952, Princess Elizabeth sat as models for artists to living room in Buckingham Castle make a portrait 5/12/15 American Headway • • 5/12/15 ... regal elegance The looks she has worn have steadily evolved into her trademark monochromatic color with matching coat and hat American Headway • • 5/12/15 She is known by every public appearance...

Ngày tải lên: 12/05/2015, 22:39

24 8,2K 9
An investigation into the style of the english language used in advertising slogans issued by some world - famous airlines

An investigation into the style of the english language used in advertising slogans issued by some world - famous airlines

... Germany Fly Euro Shuttle! Air Canada Defy obstacles Air Canada Canada World class, worldwide Air France France Air France One of the best places on earth AIR INDIA India New Zealand your place ... Wings of Man Taiwan The USA Eva Air The wings of Taiwan Frontier A whole different animal Page 43 25 Germanwings 26 Germany Hawaiian Airlines Fly high, pay low Hawaii Starts Here Iberia One of the ... Germany Lufthansa There's no better way to fly 33 Malaysia Airlines Malaysia Going beyond expectations 34 Northwest Airlines 35 Pakistan International Airline 36 PAL 37 PSA 38 Qantas Australia Qantas...

Ngày tải lên: 07/11/2012, 14:54

45 1,4K 10
Báo cáo y học: " The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3'''',3''''-" Chia sẻ:

Báo cáo y học: " The sequence of the CA-SP1 junction accounts for the differential sensitivity of HIV-1 and SIV to the small molecule maturation inhibitor 3-O-{3'''',3''''-" Chia sẻ:

... antibodies, and radioactive proteins in the immunoprecipitates analyzed by SDS-PAGE and autoradiography Panel A: Analysis of HIV-1 and HIVm2; Panel B: Analysis of SIV and SIVm3 Similar results ... was digested with SpeI and ApaI and used to replace the corresponding fragment in pNL4-3 Primers used to produce SIVm2 were: GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and GGCTTCTGCCAGTACTCGAGCCTTC ... GGCTTCTGCCAGTACTCGAGCCTTC (antisense) Primers used to produce SIVm3 were: GAAGGCTCGAGTACTGGCAGAAGCCATGAAAGAG (sense) and TGGCTTCTGCCAGTACTCGAGCCTTTC (antisense) The PCR products were cleaved with BamHI and SbfI and...

Ngày tải lên: 13/08/2014, 13:20

10 194 0
A survey on the attitude of teachers and students toward the integration of some cultural elements in the textbook New English file - elementary in speaking les

A survey on the attitude of teachers and students toward the integration of some cultural elements in the textbook New English file - elementary in speaking les

... culture; language is deeply embedded in a culture; language and culture cannot be separated, and we cannot teach a language without teaching a culture It means that teaching language is teaching ... learn a language rich in knowledge, but also raise good language habits About the meaning of gratitude and appreciation, generally speaking, we Vietnamese people rarely use "thank you" among family ... teachers are aged from 25 to 40 Most of them have at least years of teaching experience All of them graduated from Foreign Languages College Vietnam National University, Hanoi They are in charge of...

Ngày tải lên: 28/03/2015, 08:55

59 674 2
An investigation into the attitudes of teachers and students at the hanoi college of industrial economics towards speaki

An investigation into the attitudes of teachers and students at the hanoi college of industrial economics towards speaki

... English can actually use the language as a means of communication, can he master the language in the true meaning After all, speaking ability is the very signal that reveals if a person really knows ... grammatical aspects of language and use referring to communicative aspects of language According to Bock (2000) CLT is tailored to get at meaning and learners negotiate meaning in class Meaning ... the materials in such a way that the meaning of the new language is as intelligible and memorable as possible while the learners are motionless As far as we are concerned, oral materials are written...

Ngày tải lên: 19/12/2015, 12:50

56 566 1
DETERMINATION OF THE DIGESTIBILITY OF SOME PLANT INGREDIENTS FOR GRASS CARP (Ctenopharyngodon idella)

DETERMINATION OF THE DIGESTIBILITY OF SOME PLANT INGREDIENTS FOR GRASS CARP (Ctenopharyngodon idella)

... plant-ingredients is reported in table The digestibility of ash of rice bran and corn meal was higher in grass carp in comparison to cassava meal The antinutritional factors present in cassava ... Developpement of Belgium for funding this research REFERENCES Association of Official Analytical Chemists (1995) Official Methods of analysis, 16th ed Arlington, VA: AOAC Bureau, D.P., A. M Harris, C.Y ... based on plant ingredients for grass carp MATERIALS AND METHODS Rice bran, corn meal and cassava meal are three plant-ingredients originated from Son La Province, Viet nam Each ingredient was...

Ngày tải lên: 28/08/2013, 09:14

7 492 0
A STUDY ON THE EFFECTIVENESS OF SOME CLT CLASSROOM ACTIVITIES IN TEACHING VOCABULARY TO FIRST YEAR NON ENGLISH MAJOR STUDENTS

A STUDY ON THE EFFECTIVENESS OF SOME CLT CLASSROOM ACTIVITIES IN TEACHING VOCABULARY TO FIRST YEAR NON ENGLISH MAJOR STUDENTS

... basic unit of a given language resulting from the association of a particular meaning with a particular group of sounds capable of a particular grammatical employment The word is structural and ... the idea more exactly and understandably Nowadays it is generally accepted that vocabulary teaching should be part of the syllabus and taught in a wellplanned and regular basis Lewis (1993) argues ... the basis of knowledge and a part of integrated language learning in most communication And a rich vocabulary as well as knowing how to use vocabulary appropriately also improve students' ability...

Ngày tải lên: 07/09/2013, 13:04

60 1,6K 9
A study of some linguistic features of expressions describing the villains in kiều story and their english translational equivalents

A study of some linguistic features of expressions describing the villains in kiều story and their english translational equivalents

... exactly same as it appears in its dialectal words and classic references Semantically, classification of original material with clear reference to its authors, names of the data is mainly based ... Translation b Literal Translation c Faithful Translation d Idiomatic Translation e Free translation f Semantic translation g Communicative Translation Word layer based on Archaic words the negative ... woman and then abandoned her In Vietnamese popular parlance, S Khanh has come to mean a Don Juan, a heartless, unscrupulous seducer The phrases an unfaithful lover and a lady- killer have similar...

Ngày tải lên: 26/11/2013, 13:21

13 834 2
A study of the dominant topics in some typical works of augustan period (1700   1745) = nghiên cứu về những chủ đề nổi bật trong một số tác phẩm điển hình thời kì augustan (1700   1745)

A study of the dominant topics in some typical works of augustan period (1700 1745) = nghiên cứu về những chủ đề nổi bật trong một số tác phẩm điển hình thời kì augustan (1700 1745)

... died and Lovelace was killed in a fight The life of Clarissa was a chain of misery and agony Firstly, she was the victim of an arranged marriage that was completely for economical aim Solmes was ... Pamela got marriage to Mr B, a good man, a good husband, and actually became a noblewoman In the first sentences of the novel, Pamela appeared as an extraordinary girl of skill and spirit although ... carried out and the result of them was the growing of colloquialism in practice as well as in literature What is more, the appearing of a great deal of books of travel and traveling was one of...

Ngày tải lên: 14/12/2013, 00:41

47 696 0
Tài liệu Resource Mobilization, Financial Liberalization, and Investment: The Case of Some African Countries doc

Tài liệu Resource Mobilization, Financial Liberalization, and Investment: The Case of Some African Countries doc

... total savings and financial saving Total domestic saving consists of private and public savings of which financial savings is a part While financial saving is the portion of total saving that ... (Kenya, Mali, Mauritius, and Togo) and negative and statistically significant in Gambia and Madagascar The activities of the informal credit market as proxied by the ratio of currency outside banks ... significant in one case, Mauritius The relationship between the real interest rate and financial saving is negative and significant in four cases, namely Tanzania, Tunisia, Zaire and Zimbabwe Similarly,...

Ngày tải lên: 17/12/2013, 05:15

17 642 0
Some register features in agreement between the united states of america and the socialist republic of vietnam on trade relations = một số đặc điểm ngữ vực trong hiệp định thương mại việt   mỹ

Some register features in agreement between the united states of america and the socialist republic of vietnam on trade relations = một số đặc điểm ngữ vực trong hiệp định thương mại việt mỹ

... ideational meanings are realized through the transitivity systems of the grammar  Mode: What role is language playing? The mode of a text can be associated with the realization of textual meanings; ... affects and determines features of the language The aspect of the language used is at a degree of formality, accuracy, clearness and technicality of linguistics exchanges As the choice of vocabulary ... BACKGROUND xi 1.1 Context of situation In the Hallidayan (also called Australian) functional theory of language (Hyon, 1996), ’analysts are not just interested in what language is, but why language...

Ngày tải lên: 20/12/2013, 18:26

48 568 5
difficulties in teaching reading comprehension with the new english textbook “tieng anh 10” (the set of standard textbooks) to the 10th form students at ke sat high school

difficulties in teaching reading comprehension with the new english textbook “tieng anh 10” (the set of standard textbooks) to the 10th form students at ke sat high school

... the table carefully before doing the task - Ask Ss to read the passage again and scan the information about each area of change (Note: It is easy to recognize that the first paragraph is about ... relating to the theme in the next parts 2.2 Characteristics of reading passages and reading tasks in the textbook 2.2.1 Characteristics of reading passages A reading passage in the new English textbook ... comprehension of a culturally unfamiliar text is more difficult than comprehension of a culturally familiar text, because readers, facing up with unfamiliar cultural context, may mistranslate or misinterpret...

Ngày tải lên: 29/01/2014, 14:43

44 1,7K 8
Tài liệu Báo cáo " Grammatical and semantic features of some adjectives denoting happiness - the feeling of pleasure " pdf

Tài liệu Báo cáo " Grammatical and semantic features of some adjectives denoting happiness - the feeling of pleasure " pdf

... (denoting gay people) and “gayness” (n) (denoting the state of being gay) 2.3 “Glad” 2.3.1 Grammatical features and semantics of “Glad” “Glad” has a number of the syntactic functions as head of an adjectival ... “glad rags” (n) and “gladsome” (adj) “Glad eye” is a British English old-fashioned slang word meaning a look of sexual invitation” “Glad hand”, an old-fashioned informal word, means a warm welcome ... it can function as premodifier of noun phrases and complement without taking complementation 2.5 “Pleased” 2.5.1 Grammatical features and semantics of “Pleased” “Pleased”, as an adjective having...

Ngày tải lên: 12/02/2014, 20:20

10 626 1
Tài liệu (Forthcoming, The Johns Hopkins Encyclopedia of Digital Textuality) doc

Tài liệu (Forthcoming, The Johns Hopkins Encyclopedia of Digital Textuality) doc

... artistic practice has been marshaled for the sake of hackings (Bazzichelli 2008, Deseriis and Marano 2008) Hardware hacking has also been part of hacking for a long time Historically, its most notable ... Chinese hackers are quite nationalistic in their aims and aspirations (Henderson 2007), in contrast to those in North America, Latin America, and Europe, whose anti-authoritarian stance makes many—though ... Other politically-minded hackers have gravitated toward Anonymous—an umbrella term for a range of distinct and often unconnected digital operations—to engage in hacking for the sake of leaking sensitive...

Ngày tải lên: 19/02/2014, 17:20

7 498 0
Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reflection on some controversial features Elena Ghibaudi and Enzo Laurenti docx

Tài liệu Báo cáo khoa học: Unraveling the catalytic mechanism of lactoperoxidase and myeloperoxidase A reflection on some controversial features Elena Ghibaudi and Enzo Laurenti docx

... produce a value of 0.20 at neutral pH and 0.25 at basic pH, whereas, Cpd III gives 0.52 at neutral pH In no case is it possible to quantitate accurately Cpd III, as a residual amount of Cpd II is always ... chloroperoxidase) that one may look at MPO as a catalase/peroxidase A first-order rate constant of 2.2 · 106 s)1 has been reported for the catalatic breakdown of Cpd I [22] In order to explain their ... presence of mutual chemical interactions between enzyme intermediates and provides and explanation for catalase activity Other questions, such as the localization of the amino acid radical in Cpd...

Ngày tải lên: 20/02/2014, 02:21

10 529 0
w