quantification of air pollutant removal rates around a heavily afforested power plant
Báo cáo y học: " Societal costs of air pollution-related health hazards: A review of methods and results" pot
Ngày tải lên :
13/08/2014, 11:22
... contingent valuation approach Whereas the cost of the criteria pollutants was estimated on the basis of human epidemiological studies and ambient air- quality data, the cost of toxic air pollutants was ... estimate the relative risks of air pollutants To be brief, the DRF associates the quantity of a pollutant that affects a population to the physical impact on this population and a health impact can ... prematurely Average annual wages are often used to estimate the annual productivity of an average healthy person of working age Annual productivity losses are adjusted downward to obtain "net annual...
- 22
- 342
- 0
Experimental investigation of exergy destruction in a 8-kW power plant
Ngày tải lên :
05/09/2013, 16:11
... Mashhad, IRAN His main research interests are internal combustion engines and power plant analysis based on thermodynamic laws E-mail address: m_ghazikhani@Ferdowsi.um.ac.ir M Ahmadzadehtalatapeh ... products can be evaluated A 300 MW pulverized coal fired power plant located in Yiyang (China) was studied by Zhang et al [5] A cost analysis method based on thermodynamics on the power plant was investigated ... increasing trend References [1] Habib M .A. , Said S .A. M., and AL-Bagawi J.J., Thermodynamic performance analysis of the Ghazlan power plant Energy, 1995, 20 (11), 1121-1130 [2] Fiaschi D., Manfrida...
- 8
- 431
- 0
Exergoeconomic performance optimization of an endoreversible intercooled regenerative Brayton combined heat and power plant coupled to variable-temperature heat reservoirs
Ngày tải lên :
05/09/2013, 14:59
... max are the smaller and the larger of the two capacitance rates CL and Cwf , CIm in and CIm ax are the smaller and the larger of the two capacitance rates CI and Cwf N H , N L1 , N K , N I and ... dimensionless profit rate ( Π max, ) The versus a , b and τ are parabolic-like, but the value of (ηex )Π changes characteristics of (ηex )Π max, max, slightly with the changes of a and b The characteristic ... hot-side heat conductance allocation heat conductance allocation of the intercooler consumer-side heat conductance allocation cold-side heat conductance allocation heat conductance allocation of the...
- 16
- 605
- 0
Tài liệu Quantification of the Health Effects of Exposure to Air Pollution: Report of a WHO Working Group pdf
Ngày tải lên :
17/02/2014, 11:20
... requires quantification of the impact of a change in hazard rates But we may treat the calculations done so far as representing a baseline scenario; then, we may alter the hazard matrix in Table ... COMMITTEE OF THE ENVIRONMENTAL AND OCCUPATIONAL HEALTH ASSEMBLY OF THE AMERICAN THORATIC SOCIETY (ATS) Health effects of outdoor air pollution, Part American journal of respiratory and critical care ... that deaths take place throughout a year Without precise dates of each death, the usual (“actuarial”) convention is that about half the deaths in a year take place in each half of the year So,...
- 34
- 521
- 0
Appropriate methods in determining the event mean conce pollutant removal efficiency of a best management practice ntration and
Ngày tải lên :
11/10/2014, 02:19
... Health Association (APHA), American Water Works Association, Water Environment Federation Standard methods for the examination of water and wastewater 18th ed Washington, D.C.: APHA; 1992 12 Marsalek ... 20 mm of rainfall The EMC for each pollutant was calculated for each event and then categorized for each of the rainfall ranges Finally, the overall EMC was computed and compared with that of the ... The sum of the maximum rainfall for each year over a three year period was about one-third of the total rainfall over three years Table provides the rainfall data used in the calculation of the...
- 9
- 232
- 0
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
Ngày tải lên :
05/09/2013, 10:15
... gacccgatgttcaagatact ctcctcccacaaatcaggac Saito et al., 2003b QMF QMR QMT (Probe) agacgcacgctcacctcaa gagcagttcacgaaatcc atacgctcttactgtttccggccgcc in this study BACT1369F PROK1492R TM1389BACT2 ... blue-green algae, Microcystis, Anabaena, Oscillatoria and in lake Kasumigaura Environ.Tech., 14, 433-442 Park H.-D., Iwami C., Watanabe M F., Harada K.-I., Okino T and Hayashi H (1998) Temporal variabilities ... 61-72 Park H D., Sasaki Y., Maruyama T., Yanagisawa E., Hiraishi A and Kato K (2001) Degradation of the cyanobacterial hepatotoxin microcystin by a new bacterium isolated from a hypertrophic lake...
- 9
- 522
- 0
Tài liệu EFFECTS OF AIR POLLUTION FROM A NICKEL-COPPER INDUSTRIAL COMPLEX ON BOREAL FOREST VEGETATION IN THE JOINT RUSSIAN-NORWEGIAN-FINNISH BORDER AREA ppt
Ngày tải lên :
17/02/2014, 22:20
... vitis-idaea Pinus–Cladonia Betula–Vaccinium–Deschampsia Betula–Empetrum–Cladonia Pinus–Vaccinium vitis-idaea Pinus–Vaccinium vitis-idaea Betula–Vaccinium–Deschampsia Betula–Empetrum–Cladonia Pinus–Vaccinium ... measurements of the pollution impact Statistical analysis of ground vegetation and environmental variables The variation in species composition in the total dataset of 212 quadrates was analysed ... and abundance of lichens, bryophytes and vascular plants in 2004 (45 quadrates from Norway, 80 from Russia and 87 from Finland) In each quadrate, the relative cover of each species was estimated...
- 18
- 640
- 0
Atmospheric volatile organic compound measurements during the Pittsburgh Air Quality Study: Results, interpretation, and quantification of primary and secondary contributions pot
Ngày tải lên :
05/03/2014, 21:20
... and A L Robinson (2002), Sources of atmospheric carbonaceous particulate matter in Pittsburgh, Pennsylvania, J Air Waste Manage., 52(6), 732 – 741 Cabada, J C., S Takahama, A Khlystov, S N Pandis, ... interval A trap for the removal of carbon dioxide and ozone (Ascarite II, Thomas Scientific) was placed downstream of the water trap in the Rt-Alumina/FID channel An ozone trap (KI-impregnated glass ... preexisting aerosol surface area available for condensation The lower OH loss rates on nucleation days may be due to a positive correlation between gas phase reactivity and aerosol surface area (r2...
- 17
- 619
- 0
UNITED BANK OF INDIA RATES AT A QUICK GLANCE AS ON 23.04.2012 DEPOSIT ACCOUNTS. ppt
Ngày tải lên :
06/03/2014, 02:21
... citizens :10% rebate will be allowed w.e.f 01.04.2012 Cancellation of Demand Drafts./Pay Orders (inclusive of service tax) Cancellation Charges of Demand Draft Cancellation Charges of Pay Orders Rs.102/- ... service tax) Issuance of Primary Card NO CHARGE Circular no O&M/SC/3/OM041/12-13 dated 20.04.2012 Issuance of ad-on-card (joint Rs.113/account holder) Annual Fee (first year) No Charge Annual Fee ... year Rs.113/onwards) Cash withdrawal from UBI No Charge ATMs ( No limit) Cash withdrawal from other Rs.20/Bank ATMs ( per month FREE) Duplicate Card Rs.170/Duplicate Pin Rs.57/No minimum balance...
- 5
- 316
- 0
Knut Einar Rosendahl (ed.) Social Costs of Air Pollution and Fossil Fuel Use – A Macroeconomic Approach pdf
Ngày tải lên :
06/03/2014, 16:20
... cultivated meadow (i.e., surface-cultivated and fertilised pasture), and potatoes Data on agricultural areas are taken from information provided by Social Costs of Air Pollution farm operators as a ... Emissions (Ej) of pollutant j MSG-EE Ambient concentrations (Cj) of pollutant j Human and non-human damages (Dk) -Health damage -Material corrosion -Crop damage - Valuation of non-market effects ... local air pollution and distribution of materials at risk Internationally established relations between air pollution and degradation of various materials are also employed Full use is made of GIS...
- 147
- 424
- 0
Traffic-related air pollution associated with prevalence of asthma and COPD/chronic bronchitis. A cross-sectional study in Southern Sweden pdf
Ngày tải lên :
06/03/2014, 19:20
... background Descriptive data of regional air pollution at a monitoring station in a rural area Annual mean concentrations of traffic-related pollutants measured at Vavihill 1985–2006 Data source: IVL Swedish ... drafts AA: Wrote part of the manuscript and made major revisions of drafts All authors read and approved the final manuscript Acknowledgements Overall, our results show that traffic-related air ... background Descriptive data of regional air pollution at a monitoring station in Malmö Annual mean concentrations of traffic-related pollutants measured at Rådhuset Malmö 1980–2006 Data source: IVL Swedish...
- 15
- 374
- 1
The Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report pot
Ngày tải lên :
06/03/2014, 19:20
... Regulatory Impact Analysis, 2006 National Ambient Air Quality Standards for Particulate Matter, Chapter Research Triangle Park, NC: Office of Air Quality Planning and Standards, October www.epa.gov/ttn/ecas/regdata/RIAs/Chapter%205 ... for Lead, October Research Triangle Park, NC: Office of Air Quality Planning and Standards www.epa.gov/ttn/ecas/regdata/RIAs/finalpbria.pdf ——— 200 9a Proposed NO2 NAAQS Regulatory Impact Analysis ... Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report Arthur G Fraas Abstract An understanding of the uncertainty in benefit and cost estimates is a critical part of...
- 24
- 427
- 0
A review of heavy metal removal mechanisms in wetlands
Ngày tải lên :
15/03/2014, 23:06
... microbiological activity and plant uptake PURIFICATION CAPACITY OF WETLANDS Observations show that both natural and artificial wetlands have a capacity to purify wastewater containing heavy metals (Matagi, ... water and plants trapped the heavy metals The heavy metals were trapped mostly by the roots of Cyperus papyrus, the dominant plant on the landward side of the lake The roots of wetlands and plants ... and the capacity to absorb heavy metals After weeks of growth in water containing heavy metals, the plant accumulated substantial concentrations of Cu, Pb, Cd, Hg and Cr (Wolverton and McDonald,...
- 13
- 579
- 0
MEASUREMENTS OF AIR POLLUTION FROM A DANISH HIGHWAY pot
Ngày tải lên :
23/03/2014, 00:20
... there are limitations as the vehicle length 0m - 5.8m includes passenger cars and vans and even small trucks Analysis of similar data has shown that automatic traffic data are not suitable for ... station is located right next to the location of the air quality measurement equipment (Figure 2.5) Data are available for the full period of the air quality measurement campaign The traffic data ... et al., 2004) The particle mass is measured with a TEOM instrument that has a known artefact Due to the measurement principle part of the particle mass evaporates, because the particles are heated...
- 47
- 482
- 0
Spatial modelling of air pollution in urban areas with GIS: a case study on integrated database development doc
Ngày tải lên :
23/03/2014, 02:20
... In case of the ArcGIS’s geodatabase, all the data are loaded into the relational database, so that the geospatial coordinate data of the GIS data layers are stored in the relational data tables ... database, which can be useful in managing data time series To accommodate large data sets and many variables such as air quality data, climatic data, and properties of sources of pollution, a ... spatial and temporal data, complex analyses, and visualization, (Matejicek, 2002) Due to the ability to manage a number of spatial and temporal data formats, data structures created in the framework...
- 6
- 497
- 0
Economics of Air Pollution and Health in Developing Countries: A Brief Literature Survey docx
Ngày tải lên :
23/03/2014, 04:20
... Case of Santiago, Chile”, American Journal of Agricultural Economics, 79: 1636-1641 Krupnik, Alan and Anna Alberini 1997, Air Pollution and Acute Respiratory Illness: Evidence from Taiwan and ... Electricity Generation: The Case of Thailand”, Thanh and Lefevre (2000) Abstract: They apply the impact pathway approach (IPA) to estimate health impacts and corresponding damage costs of sulfur dioxide ... 'Estimating the Health Damage Costs of Air Pollution', in Holgate, S., Koren, H., Samet, J and Maynard, R (Eds), Air Pollution and Health, Academic Press, London, pp917-928 Saroa da Motta, Ronaldo...
- 11
- 474
- 1
![Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot](https://media.store123doc.com/images/document/14/rc/at/medium_ata1395562826.jpg)
Báo cáo khoa học: Properties and significance of apoFNR as a second form of air-inactivated [4Fe-4S]ÆFNR of Escherichia coli pot
Ngày tải lên :
23/03/2014, 15:20
... signal The MALDI-TOF spectrum of anaerobic apoFNR consisted of one major signal at 28 408 Da after alkylation equivalent to fivefold alkylated apoFNR, and a minor signal of threefold alkylated FNR ... residues reacted with DTNB (Table 1) The residues 4261 Disulfides of apoFNR Fig MALDI-TOF spectra of aerobically (A) and anaerobically (B) prepared and carboxymethylated apoFNR The samples of apoFNR ... aerobically and anaerobically prepared apoFNR Aerobically or anaerobically prepared apoFNR were incubated with GnHCl + iodoacetate and digested with trypsin, and after separation on Sephadex Peptide...
- 10
- 477
- 0
High Adventure A Narrative of Air Fighting in France potx
Ngày tải lên :
24/03/2014, 03:21
... have provided a splendid dramatic climax to a war drama of high adventure Civilian audiences would have watched in breathless, awe-struck silence; but at a military school of aviation it was a ... what was taking place below us, to the exclusion of any thought of aerial activity, our chances for attack or of being attacked The view, from the air, of a heavy bombardment, or of an infantry ... he says, attached to a certain army group during August and September, 1914, often met a German aviator during his reconnaissance patrols In those Arcadian days, fighting in the air was a development...
- 70
- 254
- 0
Báo cáo hóa học: " Quantification of the effects of an alpha-2 adrenergic agonist on reflex properties in spinal cord injury using a system identification technique" pptx
Ngày tải lên :
19/06/2014, 08:20
... seated and secured in an adjustable chair with the ankle strapped to the footrest and the thigh and trunk strapped to the chair The seat and footrest were adjusted to align the ankle axis of rotation ... 19 Coward DM: Neuropharmacology and mechanism of action Neurol 1994, 44(suppl 9):S6-S11 20 Chau C, Barbeau H, Rossignol S: Effects of intrathecal alpha1- and alpha2-noradrenergic agonists and norepinephrine ... rat and human central nervous system: analysis of some functional, anatomic correlates of the pharmacologic effects of clonidine and related adrenergic agents Brain Res 1984, 319:69-101 24 Nance...
- 7
- 465
- 0