0

ptc prop genetics supertasting is not explained by a single gene

Báo cáo khóa học: Fidelity of targeting to chloroplasts is not affected by removal of the phosphorylation site from the transit peptide doc

Báo cáo khóa học: Fidelity of targeting to chloroplasts is not affected by removal of the phosphorylation site from the transit peptide doc

Báo cáo khoa học

... 104–108 Alam, R., Hachiyan, N., Sakaguchi, M., Kawabata, S., Iwanaga, S., Kitajima, M., Mihara, K & Omura, T (1994) cDNA cloning and characterization of mitochondrial import stimulation factor ... quadruplication of Arabidopsis thaliana cysteinyl- and asparaginyl-tRNA synthetase genes of organellar origin J Mol Evol 50, 413–423 Akashi, K., Grandjean, O & Small, I (1998) Potential dual targeting ... phosphorylated serine or threonine residue was altered to an alanine, and also a double mutant where the upstream serine was also changed to an alanine (Table 1) All mutations were verified by DNA sequence...
  • 8
  • 378
  • 0
Báo cáo khoa học: [Na+]i-induced c-Fos expression is not mediated by activation of the 5¢-promoter containing known transcriptional elements ppt

Báo cáo khoa học: [Na+]i-induced c-Fos expression is not mediated by activation of the 5¢-promoter containing known transcriptional elements ppt

Báo cáo khoa học

... Quickchange site-directed mutagenesis kit (Stratagene, La Jolla, CA, USA), following the recommendations of the manufacturer, with the sense primer CTCCCCCCTTACACAGGATG TGGATATTACCACATCTGCGTCAGC and ... electrophoresis, transferred to a Hybond N+ membrane (Amersham Pharmacia Biotech, ´ Baie d’Urfe, PQ, Canada), UV-immobilized and hybridized to 32P-labeled probes c-Fos mRNA forward (AGG AATAAGATGGCTGCAGCCAAG) ... indicate that c-Fos expression in ouabain-treated HeLa cells is caused by inhibition of Na+ ⁄ K+-ATPase-mediated ion fluxes and elevation of [Na+]i Evidence of Ca2- and extracellular regulated kinase...
  • 11
  • 449
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " The synergistic effect of IFN-α and IFN-γ against HSV-2 replication in Vero cells is not interfered by the plant antiviral 1-cinnamoyl-3, 11-dihydroxymeliacarpin" pptx

Hóa học - Dầu khí

... pha + gamma + + + + CDM +gamma alpha+gamma + + + CDM +a+ g (c) 10 CDM + - + - + + - + + + + + + + + + CDM IFNIFN- al pha CDM + al pha gamma CDM +gamma alpha+gamma + - al pha + - CDM + al pha + ... Purification and partial characterization of an antiviral active peptide from Melia azedarach L Antivir Chem Chemother 1994, 5:105-110 Barquero AA, Alché LE, Coto CE: Antiviral activity of meliacine ... in female mice infected intravaginally with HSV-2 was also ameliorated by MA treatment [10] On the other hand, besides its broad effect of antiviral action, meliacine acts as an immunomodulator...
  • 10
  • 544
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Vaccinia virus replication is not affected by APOBEC3 family members" pptx

Hóa học - Dầu khí

... Heidelberg) and a FITC-conjugated anti-mouse IgG antibody (Dianova, Hamburg) followed by FACS analysis B: Viral replication is not impaired by APOBEC3G expression HeLa-APOBEC3G and HeLa cells were ... by FACS analysis Western blot analysis Cell lysates were obtained and Western blot analysis was performed as described previously [28] Western blot analysis was performed with the following antibodies: ... determined by intracellular staining with a mouse anti-Myc antibody (BDBiosciences, Heidelberg) and a FITC-conjugated antimouse IgG antibody (Dianova, Hamburg) followed by FACS analysis, which...
  • 8
  • 308
  • 0
Báo cáo lâm nghiệp:

Báo cáo lâm nghiệp: " Partitioning of remobilised N in young beech (Fagus sylvatica L.) is not affected by elevated [CO2]" ppsx

Báo cáo khoa học

... elevated [CO2] This was associated with a significant decrease in N concentration in the aboveground compartments under elevated [CO2] (data not shown) These data might indicate that N demand was ... in beech is not affected by elevated [CO2] 287 increased N stores formation have been reported earlier for Alnus glutinosa [18] but also for Robinia pseudoacacia [7, 12], and the tropical tree ... elevated [CO2], which is comparable to results we obtained earlier [6] Labelled N made up 24.7% of total N before bud break (Fig 1) As a result of N uptake from the soil, this value gradually...
  • 4
  • 266
  • 0
Báo cáo y học:

Báo cáo y học: "Synovial expression of IL-15 in rheumatoid arthritis is not influenced by blockade of tumour necrosis factor" docx

Báo cáo khoa học

... necrosis factor (TNF; mAb1 and mAb11) and IFN-γ) was measured before treatment and after a median of weeks of treatment with infliximab in patients with rheumatoid arthritis aA semi-quantitative analysis ... the stained tissue area, with ranges in parenthesis ns, not significant Immunohistochemical analysis CD-markers The results of the semi-quantitative analysis of the staining for CD markers are ... computerized image analysis of IL-1α and IL-1ß SE, AU, AIC, EaK and LK prepared the manuscript All authors read and approved the final manuscript Acknowledgements This study was supported by the Swedish...
  • 8
  • 317
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Preprandial ghrelin is not affected by macronutrient intake, energy intake or energy expenditure" docx

Báo cáo khoa học

... ghrelin analysis, data collection, statistical analysis and manuscript preparation All authors read and approved the final manuscript References Wren AM, Small CJ, Ward HL, Murphy KG, Dakin CL, Taheri ... Hosada H, Teramukai S, Matsuyama A, Tada H, Miura K, Shimizu A, Fukushima M, Yokode M, Tanaka K, Kangawa K: Pharmacokinetics, safety, endocrine and appetite effects of ghrelin administration ... in humans J Clin Endocrinol Metab 2001, 86:5992-5995 Shiiya T, Nakazato M, Mizuta A, Date Y, Mondal MS, Tanaka M, Nozoe SI, Hosada H, Kangawa K, Matsukura S: Plasma ghrelin levels in lean and obese...
  • 8
  • 321
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Resting energy expenditure is not influenced by classical music" ppsx

Báo cáo khoa học

... design and coordination and drafted the manuscript All authors read and approved the final manuscript Acknowledgements The authors are grateful to Lena Hulthén, professor at Dept of Clinical Nutrition, ... disc SD – standard deviation Authors' contributions EC and HH participated in the study design, carried out the data collection and analyzed the results FS conceived the study, and participated ... each part of the music, as calm or stressful, or something else Data are presented as mean and standard deviation To compare REE during silence to the calm and stressful music, two-sided paired...
  • 2
  • 236
  • 0
báo cáo khoa học:

báo cáo khoa học: " Awareness of the need for safe storage of Methadone at home is not improved by the use of protocols on recording information giving" doc

Báo cáo khoa học

... shown that all patients and all pharmacists report that methadone is always dispensed with child resistant caps on This was the only criterion that reached a 100% standard The provision of measuring ... (10.7%) pharmacists reported that an information leaflet about safe storage of methadone is provided when the patient starts the methadone programme All 28 (100%) pharmacists dispensed the methadone ... Discussion The safety of storage of Methadone can be improved by a number of factors: Safe storage containers Pharmacists have a responsibility not only to ensure that any methadone that is prescribed...
  • 6
  • 383
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Induction of cell-cell fusion by ectromelia virus is not inhibited by its fusion inhibitory complex" doc

Báo cáo khoa học

... titrated on BS-C-1 monolayers and inactivated by betapropiolactone (βPL) (Serva, Germany) For preparation of the anti IMV and anti EEV antisera, rabbits (New Zealand white, female) were vaccinated ... immunochemical (MO, USA) As secondary antibody reagents, we used Alexa-555-conjugated goat anti mouse or anti rabbit antibodies and Alexa488-conjugated goat anti mouse or goat anti rabbit antibodies (Invitrogen, ... design, data analysis and manuscript preparation GMR did the immunoprecipitation and immunoblot assays BP participated in in-vivo experiments and prepared histology samples PS and PF participated...
  • 13
  • 329
  • 0
Báo cáo y học:

Báo cáo y học: " Differentiated transplant derived airway epithelial cell cytokine secretion is not regulated by cyclosporine" pdf

Báo cáo khoa học

... GATCTCGGCCAGCCAGATC-3’ EDA-FN 5’-GAGCTATTCCCTGCACCTGATG-3’ 5’-CGTGCAAGGCAACCACACT-3’ TGF-b 5’-ACCGGCCTTTCCTGCTTCTCA-3’ 5’-CGCCCGGGTTATGCTGGTTGT-3’ GAPDH 5’-AGCCACATCGCTCAGACACCA-3’ 5’-GCAAATGAGCCCCAGCCTTC-3’ ... basal IL-1 b treatment was Table Primers used for real-time RT-PCR Gene Forward Reverse E-cadherin 5’-CGGGAATGCAGTTGAGGATC-3’ 5’-AGGATGGTGTAAGCGATGGC-3’ a- SMA 5’-CTGGCATCGTGCTGGACTCT-3’ 5’- GATCTCGGCCAGCCAGATC-3’ ... dysfunction Am J Transplant 2005, 5(1):131-138 Jaramillo A, Naziruddin B, Zhang L, Reznik SI, Smith MA, Aloush AA, Trulock EP, Patterson GA, Mohanakumar T: Activation of human airway epithelial cells by...
  • 9
  • 389
  • 0
Báo cáo y học:

Báo cáo y học: " TRIM5α and TRIMCyp form apparent hexamers and their multimeric state is not affected by exposure to restriction-sensitive viruses or by treatment with pharmacological inhibitors" doc

Báo cáo khoa học

... 353:234-246 Langelier CR, Sandrin V, Eckert DM, Christensen DE, Chandrasekaran V, Alam SL, Aiken C, Olsen JC, Kar AK, Sodroski JG, Sundquist WI: Biochemical characterization of a recombinant TRIM5alpha ... TRIMCyp was found as dimers, trimers, and hexamers (Fig 4B, lower panel) An additional band migrating faster than the hexamer was visible and could be a pentamer In both cases, the experiment was done ... then separated on an 8% polyacrylamide gel, transferred to a nitrocellulose membrane, and probed with a rabbit anti-FLAG antibody (Cell Signaling) The apparent multimeric states are indicated on...
  • 7
  • 170
  • 0
Báo cáo y học:

Báo cáo y học: " The virion-associated incoming HIV-1 RNA genome is not targeted by RNA interference" pps

Báo cáo khoa học

... (LDR9; AGATGGGTGCGAGAGCGTC [798], Pol29; CAGTGCAGGGGAAAGAATA [4811] and Nef19; GGGACTGGAAGGGCTAATT [9081] ter Brake et al.; in press) or the Nef [24] sequence, were annealed and ligated into pSUPER ... sequence emerge after prolonged culturing [22,24] We have also demonstrated that HIV-1 can gain resistance against RNAi through mutations that mask the target in a stable RNA secondary structure ... 3:57 RNAi can be used as a therapeutic strategy against human pathogenic viruses such as HIV-1 [10] Several studies have demonstrated that HIV-1 replication can be inhibited transiently by transfection...
  • 9
  • 283
  • 0
Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

Báo cáo khoa học

... uuaccugccaucaau; ZIP8 #2, ccgauuucaccuucuucaugauuca; ZIP8 #3, ggauuccugucagugacgauuauua; eGFPsi, gcaagcuga cccugaaguucau; PKCa #1, ccaucggauuguucuuucuucauaa; PKCa #2, gccuccauuugauggugaagaugaa; ... PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy Pontoise, France) Only ... described Statistical analysis Results were analyzed for statistical significance using a one-way anova parametric test and Turkey pairwise comparisons P-values are indicated on the figures Acknowledgements...
  • 13
  • 331
  • 0
Báo cáo khoa hoc:

Báo cáo khoa hoc:" Perigraft air is not always pathological: a case report" docx

Báo cáo khoa học

... negative, and inflammatory markers remained within normal limits As the patient was now apyrexial and continued to be asymptomatic, the decision was made to discharge the patient A repeat CT scan performed ... reconstructive aortic surgery, performing a CT scan at 7, 48 and 102 days post-operatively Only patients had perigraft air at days, and this air had completely resolved by day 28 O'Hara et al looked at 26 ... patients, scanning them on days 3, and 52 Seventeen patients had perigraft air on day 3, and seven on day No patient had residual perigraft air on the final scan There is however no data regarding...
  • 3
  • 280
  • 0
báo cáo khoa học:

báo cáo khoa học: "Parthenocarpic potential in Capsicum annuum L. is enhanced by carpelloid structures and controlled by a single recessive gene" docx

Báo cáo khoa học

... each treatment on each genotype at each temperature was tested separately by using a one way analysis of variance (ANOVA) Mean separation was done by student’s t-test Data processing and statistical ... annuum is not caused by a mutation in CaARF8 Similar to tomato and Arabidopsis, a mutation in the ARF8 gene might lead to the parthenocarpic phenotype in Line Sequence analysis was performed for a ... (Addition file 3), indicating that the differences in parthenocarpy are not caused by mutations in the CaARF8 gene Discussion Most C annuum genotypes have parthenocarpic potential As an initial...
  • 15
  • 374
  • 0
Báo cáo y học:

Báo cáo y học: "Human cyclin T1 expression ameliorates a T-cell-specific transcriptional limitation for HIV in transgenic rats, but is not sufficient for a spreading infection of prototypic R5 " ppt

Báo cáo khoa học

... sequence in tail biopsy DNA samples (5'primer: GAT ACT AGA AGT GAG GCT TAT TTG, 3'-primer: CAG ATA GTC ACT ATA AGG ACG AAC) and selected for further matings with n-tg Sprague-Dawley rats Transgene expression ... translate into an enhanced viral gene expression in this primary cell type, and already macrophages from n-tg rats are at a level comparable to human MDM This may, in part, relate to the ability of HIV-1 ... 12(4):971-982 Wada T, Takagi T, Yamaguchi Y, Ferdous A, Imai T, Hirose S, Sugimoto S, Yano K, Hartzog GA, Winston F, Wada T, Takagi : DSIF, a novel transcription elongation factor that regulates RNA polymerase...
  • 19
  • 263
  • 0
Báo cáo y học:

Báo cáo y học: "NGAL: an emerging tool for predicting severity of AKI is easily detected by a clinical assay" potx

Báo cáo khoa học

... Dial Transplant 2008, 23:3737-3743 Haase M, Bellomo R, Devarajan P, Schlattmann P, Haase-Fielitz A: Accuracy of neutrophil gelatinase-associated lipocalin (NGAL) in diagnosis and prognosis in acute ... clinical settings [3] Most of the studies evaluating NGAL as a predictor of AKI used a research-based ELISA assay The availability of a standardized clinical platform for NGAL measurement would make ... death This was a well-done study showing the promise of a new clinical assay and a rming the significant delay in diagnosing AKI via changes in serum creatinine, which did not show statistical...
  • 2
  • 245
  • 0
Báo cáo Y học: Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution pdf

Báo cáo Y học: Restoring enzyme activity in nonfunctional low erucic acid Brassica napus fatty acid elongase 1 by a single amino acid substitution pdf

Báo cáo khoa học

... CUT1 (accession number AF129511) and amino acids 264–323 from A thaliana FAE1 (accession number AF053345), HEA B napus cv.s Golden and Ascari (accession numbers AF00953 and AF274750), HEA B napus ... Alteration of seed fatty acid composition by an ethyl methanesulfonate-induced mutation in Arabidopsis thaliana a ecting diacylglycerol acyltransferase activity Plant Physiol 108, 399–409 Bradford, ... expression in yeast Based on known FAE1 sequences from Arabidopsis and B napus, the forward primer VBE4 (5¢-ACCATG ACGTCCATTAACGTAAAGCTCC-3¢) and the reverse primer VBE3 (5¢-GGACCGACCGTTTTGGGCACG-3¢)...
  • 7
  • 381
  • 0
Báo cáo hóa học:

Báo cáo hóa học: " Si nanowires by a single-step metal-assisted chemical etching process on lithographically defined areas: formation kinetics" docx

Hóa học - Dầu khí

... that takes place is a galvanic displacement reaction A galvanic cell is established when the Si wafer is immersed into the solution because the reduction potential of the Ag+/Ag couple is more positive ... doi:10.1186/1556-276X-6-597 Cite this article as: Nassiopoulou et al.: Si nanowires by a single- step metal-assisted chemical etching process on lithographically defined areas: formation kinetics Nanoscale Research Letters ... Encyclopedia of Nanoscience and Nanotechnology Volume Edited by: Nalwa HS California: American Scientific Publishers; 2004:793-813 Zianni X, Nassiopoulou AG: Optical properties of Si quantum wires and...
  • 8
  • 395
  • 0

Xem thêm

Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25