... LPSs is due to an increase in the rate of the initial fast phase, i.e. oxidation of the a chains. The rates of oxidation are reduced in the presence of chelators of heavy metal cations in most cases. ... oxidation mediated by the smooth LPS was less affected by the presence of EDTA. The rough S. minnesota LPS increased the initial fast phase of the reaction, but decreased the rate of the slow phase ... in concentration of oxyHb with time was utilized as a measure of the rate of oxidation of oxyHb. RESULTS The effect of pH on the auto-oxidation of cross-linked Hb was studied. The rate of decrease of the...
Ngày tải lên: 08/03/2014, 10:20
krafft carl - gravitation is a function of the aether vortex proton
...
Ngày tải lên: 04/06/2014, 12:23
Báo cáo sinh học: " The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
... the premature release of unassembled viral RNA. It may also enhance virus packaging as it appears that the assembly of coronavirus occurs intracellularly, probably in the intermediate compartments ... human coronaviruses, Table 1: Amino acid sequences of the cytoplasmic tail of spike (S) proteins of coronaviruses are compared with the YxxΦ (where x is any amino acid and Φ is an amino acid ... between the endoplasmic reticulum and Golgi apparatus [24]. Clearly, this has certain advantages for the virus at certain stages of its life cycle. In addition, a reduction in the cell surface expression...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" The Severe Acute Respiratory Syndrome (SARS)-coronavirus 3a protein may function as a modulator of the trafficking properties of the spike protein" docx
... (diacidic) motif was found to be essential for the transport of 3a to the cell surface, consistent with the role of these motifs in the transportation of other pro- teins to the plasma membrane ... Health Organization, http://www.who.int/csr/ sars/country/en/). A novel coronavirus was identified as the aetiological agent of SARS [1]. Analysis of the nucle- otide sequence of this novel SARS ... [13,15]. Presentation of the hypothesis The cellular fate of the S protein has been well mapped [16,17]: S is cotranslationally glycosylated and oligomer- ized at the endoplasmic reticulum. Its N-linked high man- nose...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo vật lý: "The Hidden Property of Arrhenius-type Relationship: Viscosity as a Function of Temperature" doc
... ini, satu persamaan untuk menggantikan hubungan jenis Arrhenius telah diterbitkan. Ini adalah kerana pemalar tenaga keaktifan daripada persamaan itu bukan dalam bentuk asas. Persamaan baru ini ... mengekalkan sifat asal tenaga keaktifan dan kelikatan pada suhu tidak terhingga, dan ia merangkumi pemalar baru, iaitu kelikatan pada suhu sifar. Nisbah kelikatan pada suhu sifar dan kelikatan ... pada suhu tidak terhingga merupakan nilai asas untuk pemalar tenaga keaktifan. Model ini telah diuji dengan enam minyak sayur-sayuran dan kejituannya terbukti (R kuasa dua, 0.999). Kestabilan...
Ngày tải lên: 07/08/2014, 14:20
Báo cáo y học: " Assessment of FIV-C infection of cats as a function of treatment with the protease inhibitor, TL-3" pot
Ngày tải lên: 13/08/2014, 13:20
Báo cáo y học: "A general framework for quantifying the effects of DNA repair inhibitors on radiation sensitivity as a function of dose" pptx
Ngày tải lên: 13/08/2014, 16:21
Reading Theory as a Microcosm of the Four Skills
... giving the L2 student both as much input and practice as they can reasonably manage, and a strong metalinguistic awareness, we, as teachers give the student the tools to learn a language proficiently. ... One of the most important initial tasks for any teacher is the task of knowing his clients. The notion of needs analysis is absolutely central. Even with as few details as we have outlined above, ... only taught as a means to accessing literature, be it classical, technical or otherwise. Any of the group that actually work, will almost certainly be trying to improve their English, as a means...
Ngày tải lên: 06/09/2013, 10:10
Characterization of Spin Coated Polymers in Nano-environments as a Function of Film Thickness pot
... 12 2.6 Thermal Mechanical Analysis 2.6.1 Theory Thermal mechanical analysis can be used to assess the glass transition of a thin film system. The sample is placed in a temperature-controlled chamber ... properties of diverse samples. The linearly polarized light is reflected off the sample surface. Data are taken across an area of the surface and averaged to give a more accurate representation of the ... used. Although the value of permittivity began at a reasonable value, it increased as the temperature increased. This increase could have been caused by a build up of charge between the plates. 0 5 10 15 20 Permittivity 20...
Ngày tải lên: 23/03/2014, 01:20
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... Idem MAP2-for MAP2-rev GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC 91489–91517 92431–92404 NC_000067 Idem Tau-for Tau-rev GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC 78772–78800 79013–78981 NC_000077 Idem STOP-for STOP-rev AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG 210–237 657–631 NC_000073 ... [11,12,45]. Investigations on the biochemical basis of lissencephaly, a human neurological disease characterized by an abnormal layering of brain cortex, led to the discovery of these two proteins, which are lacking ... Idem Doublecortin-for Doublecortin-rev CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG 705–728 967–943 NM_010025 Idem LIS1-for LIS1-rev CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG 1288–1303 1427–1407 NM_95116 Idem Tubulin a6 -for Tubulin a6 -rev AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 6854–6876 7646–7624 NC_000081...
Ngày tải lên: 23/03/2014, 05:22
báo cáo hóa học: " Physical activity as a mediator of the impact of chronic conditions on quality of life in older adults" pptx
... indicate whether they had a disease or another health condition diagnosed by a health professional that had lasted, or was expected to last, 6 months or more. These data were used to classify the ... the authority of the Statistics Act. Access to the data was granted by Statistics Canada based on a peer-reviewed proposal for this study. The researchers did not have access to any identifying information ... of other studies. For example, adequate physical activity was associated with a signifi- cant reduction in the number of days of poor physical and mental health status in adults with arthritis...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo y học: "Cornual pregnancy as a complicaton of the use of a levonorgestrel intrauterine device: a case report" pdf
... Cases Database Any patient, any case, can teach us something www.casesnetwork.com general practitioner the same day. She had no history of prior ectopic pregnancy, pelvic inflammatory diseases ... consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal. Competing ... whereas an interstitial pregnancy implants within the myometrium of the proximal and intramural portion of the fallopian tube [5]. Most of the risk factors of ectopic pregnancies are known. The...
Ngày tải lên: 11/08/2014, 14:20
Báo cáo khoa học: " Air embolism as a cause of the systemic inflammatory response syndrome: a case report" pps
... were heard. The patient was orally intubated and placed on mechanical ventilation. A diagnosis of venous air embolism was made and the patient was taken to a hyper- baric chamber for treatment ... (elevated cardiac output, decreased systemic vascular resistance, tachypnea, fever and diffuse intravascular coagulation) was compatible with the diagnosis of SIRS. The rapidity of the patient’s ... aggregation and the release of plasminogen- activator inhibitor [13]. This mechanism has been implicated as a trigger to the cascade of cytokines thought to be causative agents of SIRS, among them...
Ngày tải lên: 12/08/2014, 19:22
Báo cáo khoa học: "Regional distribution of acoustic-based lung vibration as a function of mechanical ventilation mode" docx
... (Figure 6b). Regional area analysis demonstrated that the increase in the total area was due to the expansion of the lower lung region whereas areas in the upper and the middle regions decreased (Table 3). Assessment ... to assess the regional distribution of vibration in the lungs: image analysis and raw numerical data calculation. In contrast to image analysis, the numerical method was not affected by normalization. ... predefined rules and criteria listed below. The MEF area of the VRI image was measured using the software ImageJ (National Institute of Health, Bethesda, MD, USA) [15]. Regional areas were obtained by...
Ngày tải lên: 13/08/2014, 03:20
Báo cáo y học: "Changes in regional distribution of lung sounds as a function of positive end-expiratory pressure" potx
Ngày tải lên: 13/08/2014, 16:20
Báo cáo y học: "Gene expression response in target organ and whole blood varies as a function of target organ injury phenotype" ppsx
Ngày tải lên: 14/08/2014, 20:22
the subsidy regulations and vietnam’s position as a member of the wto
Ngày tải lên: 18/08/2014, 12:35
computational and experimental analyses of transcriptional regulation as a function of dna sequence
Ngày tải lên: 14/11/2014, 06:05
Báo cáo khoa học: "Cystatin C: unsuited to use as a marker of kidney function in the intensive care unit" pot
... this issue are warranted. Competing interests The author(s) declare that they have no competing interests. References 1. Villa P, Jiménez M, Soriano MC, Manzanares J, Casasnovas P: Serum cystatin ... M, Piera C, Darnell A: Serum cystatin C as a new marker for non- invasive estimation of glomerular filtartion rate and as a marker for early renal impairment. Am J Kidney Dis 2000, 36: 29-34. ... C as a marker of acute renal dysfunction in critically ill patients. Crit Care 2005, 9:R139-R143. 2. O’Riordan SE, Webb MC, Stowe HJ, Simpson DE, Kandarpa M, Coakly AJ, Newman DJ, Saunders JA,...
Ngày tải lên: 12/08/2014, 22:21