Food emulsions, fourth edition
... always created (e.g., by homogenization) at a temperature at which all of the fat or oil is in a liquid state, and crystallization then occurs as the product is cooled to the temperature at which ... emulsion using one protein and then to attempt to displace that protein from the interface with another It is a general finding, however, that usually the protein which is first on the interface resists ... to the oil–water interface When a protein is adsorbed, the structure of the protein itself (the polypeptide backbone) will prevent close packing of the points of contact with the interface (the...
Ngày tải lên: 23/05/2014, 11:36
... accelerate our understanding of HCV replication and propagation 1.3 HCV protein- protein interaction Viral proteins are known to interact with one another in the formation of the viral replication ... machineries in the host for viral protein translation, and other cellular components for their replication HCV proteins were reported to associate with several host proteins E2 binds the putative cellular ... dimerization mutant (Y267S) with wild-type helicase did not dramatically affect helicase activity These data indicate that dimerization of the helicase is important for XI helicase activity The mutations...
Ngày tải lên: 16/09/2015, 17:12
... indicated interaction of the purified protein with the motif No shift was observed in the presence of GST protein only (lane 2) EMSA with mutants of the bp motif AAAGA CATG indicated that AAAGAGATG ... ruled out The above results showed that purified GST–HIPPI interacted with the bp motif AAAGACATG present at the upstream sequence () 101 to ) 93) of the caspase-1 gene, and that mutation at the sixth ... GST–HIPPI in the presence of these mutants This result revealed that GST– HIPPI did not interact with these mutated sequences of the bp motif (Fig 1B, panel II) To explore the nature of the interactions...
Ngày tải lên: 07/03/2014, 10:20
Báo cáo khoa học: Interaction of synthetic peptides corresponding to hepatitis G virus (HGV/GBV-C) E2 structural protein with phospholipid vesicles doc
... fluorescence intensity at the beginning of the titration, F1 the fluorescence at the end of the titration, Kd the dissociation constant, and [Ltot] the total lipid concentration [30] 2463 HGV ⁄ GBV-C fusion ... calculated from plots of the fluorescence intensity at 350 nm, expressed as the percentage of the fluorescence of the lipid- free peptides vs the added lipid concentration The data were analysed using ... show that, in lipid- free peptides, Trp residues are highly exposed to water To investigate the contribution of electrostatic interactions, the peptides were titrated with both neutral and negatively...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Krit 1 interactions with microtubules and membranes are regulated by Rap1 and integrin cytoplasmic domain associated protein-1 doc
... polarization and facilitates cell migration Expression of activated Rap1 polarizes lymphocytes, generating a leading edge at the front and a uropod at the back It also stimulates lymphocyte endothelium ... and binds to PIP2 The molecular modelling of the last 300 amino acid residues of Krit1 that we generated corroborates the existence of a FERM domain at the C-terminus of the protein FERM domains ... Furthermore, we have shown that the N-terminal NPAY motif is involved in the interaction, which suggests that the PTB-like F3 subdomain of the FERM is the C-terminal counterpart As such, in the...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Cdc37 maintains cellular viability in Schizosaccharomyces pombe independently of interactions with heat-shock protein 90 doc
... contrast to the inviability of strains expressing the same truncations at wild-type levels (Fig 2C) These data indicate that the truncated proteins have reduced function but this is compensated by ... viability These truncated proteins not contain the postulated Hsp90-binding domain, suggesting that binding of the cochaperone Hsp90 by Cdc37 is not required for cellular viability These data indicate ... of the Cdc37 truncation protein with that of endogenous full length protein All truncation mutants except for Cdc37(1–155) yielded a truncated protein that was detected by western blot with the...
Ngày tải lên: 16/03/2014, 22:20
Báo cáo Y học: Domain V of m-calpain shows the potential to form an oblique-orientated a-helix, which may modulate the enzyme’s activity via interactions with anionic lipid potx
... negatively charged membrane lipid Furthermore, to achieve the deeper levels of membrane penetration indicated for Myr2PtdSer membranes, it is possible that these interactions may involve the ... on the hydrophobic moment plot diagram (Fig 1) The data points representing these sequences lie proximal in the area delineating candidate oblique-orientated a-helix-forming segments, indicating ... monolayers at a surface pressure of 30 mNÆm)1, which was taken to represent that of naturally occurring membranes At a final subphase concentration of 20 lM, There is evidence to suggest that the enzymatic...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: Deciphering the key residues in Plasmodium falciparum b-ketoacyl acyl carrier protein reductase responsible for interactions with Plasmodium falciparum acyl carrier protein pptx
... CCGCTCGAGAGGTGATAGTCCACCGTCTATTACGAAAA CTCG TAATAATGCGTATGGTCGAATAATTA GACCATACGCATTATTAATCATTCTT TAATAATGAATATGGTCGAATAATTA GACCATATTCATTATTAATCATTCTT AATAATAAATACGGCCGAATAATTA TAATTATTCGGCCGTATTTATTATT AGCTTCAGCCAATATAACTGTAAATG ... AGCTTCAGCCAATATAACTGTAAATG CATTTACAGTTATATTGGCTGAAGCT AGCTTCAGAAAATATAACTGTAAATG CATTTACAGTTATATTTTCTGAAGCT TATGGTGCCATAATTAATATTTCAAGT ACTTGAAATATTAATTATGGCACCATA TATGGTGAAATAATTAATATTTCAAGT ACTTGAAATATTAATTATTTCACCATA ... of Plasmodium) In the type II FAS pathway, the growing acyl intermediates are attached to the terminal sulfhydryl of the 4¢-phosphopentatheine prosthetic group [13], which is attached via a phosphodiester...
Ngày tải lên: 23/03/2014, 10:20
Báo cáo khoa học: Interaction of ostreolysin, a cytolytic protein from the edible mushroom Pleurotus ostreatus, with lipid membranes and modulation by lysophospholipids pptx
... indicate that the formation of a functional pore requires the growth of ostreolysin aggregates on, or within, the erythrocyte membrane The observation that maximal hemolysis rate was saturated at ... line) at the lipid /protein ratio (w/w) 3.25 (B) Time course of the increase of relative uorescence intensity F/F0 SEL SUVs were added to 5.13 lgặmL)1 ostreolysin at the indicated lipid /protein ratio ... considering that the average orientation shown by the lipid chains in the same spectra was between 42 and 44 , we could recalculate the relative orientation of the a-helix with respect to the lipid...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Secretion of a peripheral membrane protein, MFG-E8, as a complex with membrane vesicles A possible role in membrane secretion pptx
... was then added to the supernatants of the centrifugation, followed by the incubation on ice for 10 These samples with or without Triton X-100 were ultracentrifuged at 100 000 g for h at °C The ... association To determine whether the secreted MFG-E8 associates with proteins or other components such as lipid, phospholipid and membrane vesicle, the culture supernatant was ultracentrifuged at ... indicating that both of the MFG-E8 proteins secreted by COMMA-ID cells were completely precipitated under the ultracentrifugation condition used The precipitation by ultracentrifugation at 100...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo khoa học: Interactions of the antimicrobial b-peptide b-17 with phospholipid vesicles differ from membrane interactions of magainins potx
... cause the formation of nonlamellar structures, but rather that it will facilitate the formation of transient structures with increased negative curvature b-17 also promotes negative curvature ... penetrate more deeply into the membrane than the parent peptide, magainin II Deeper membrane penetration also facilitates the promotion of negative curvature, as the regions of the bilayer below the ... Ole2PtdEtn, despite their similarity in chemical structure The presence of the anionic Ó FEBS 2003 lipids in the membrane allows for the formation of stable liposomes at room temperature in the presence...
Ngày tải lên: 31/03/2014, 07:20
A validated molecular docking study of lipid–protein interactions
... if the ligand is protein and the receptor is also a protein then it is protein- protein interactions Similarly, if the ligand is a lipid and the receptor is protein then it is termed as lipid -protein ... can calculate the binding affinity for any pair of protein and ligand Student Declaration “I, Rajyalakshmi Gaddipati, declare that the PhD thesis entitled The Study of Lipid -Protein Interactions ... the study aims on 80 lipid -protein interactions Furthermore, the purpose of this thesis is discussed below: The aim is to study the 80 lipid -protein interactions in terms of their binding affinities,...
Ngày tải lên: 28/11/2015, 14:01
Tài liệu Báo cáo khoa học:Tyrosine phosphorylation of tau regulates its interactions with Fyn SH2 domains, but not SH3 domains, altering the cellular localization of tau ppt
... establish whether or not tau interacts with Fyn-SH2, as this would probably reveal that the tyrosine phosphorylation status of tau is important for mediating the association of these two proteins ... found that the tyrosine phosphorylation status of tau regulates its interactions with Fyn-SH2, it is possible that interactions between tau and Fyn-SH2 play an important role in regulating the intracellular ... responses to elevated Ab levels in models of AD [8], suggesting that disruption of the association of these proteins could represent a potential therapeutic strategy for the treatment of AD Here,...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Transient RNA–protein interactions in RNA folding docx
... represent the flexible residues within the protein domain NMR data 1638 provide evidence that the interaction site on the RNA is the phosphate backbone This is also in accordance with the demonstrated ... assay, even at very low salt concentrations As the latter assay would require the formation of a stable complex, the formation of only transiently populated RNA protein complex states can be ... compared with the wild-type peptide Thermodynamic calculations regarding the transition state of the reaction explained the importance of the overall charge for the activity – the total peptide...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Transient DNA ⁄ RNA-protein interactions docx
... protein DNA interfaces illustrate our increased ability to achieve these goals by the manipulation of the direct readout interactions [40] By use of the crystal structures of the complexes, these ... range [21] Translocation is the final step in polypeptide chain elongation, and involves the concerted movement of the tRNAs, the mRNA, and the 30S subunit relative to the 50S one The authors used ... pathway: glutamylation of the tRNAGln (by the same low-specificity enzyme that glutamylates the tRNAGlu), and amidation by the corresponding amidotransferase The crystal structure of the ‘glutamine...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu The Acquisition of Drugs and Biologics for Chemical and Biological Warfare Defense - Department of Defense Interactions with the Food and Drug Administration doc
... drugs, the comprehensive nature of FDA regulation, the continual change in those regulations and in FDA’s interpretation of them, and the limited information each agency has about the other We ... through the FDA regulatory process to the market Finally, the costs of developing a new drug are very high Estimates by the Tufts [University] Center for the Study of Drug Development updated the ... products The DoD acquisition objective requires that products receive FDA licensing Closely linked to licensing are the interactions related to the use of INDs in combat (and other special) situations...
Ngày tải lên: 17/02/2014, 11:20
Tài liệu Báo cáo khoa học: Cobalamin uptake and reactivation occurs through specific protein interactions in the methionine synthase–methionine synthase reductase complex docx
... and incubated at 37 °C for The reaction was initiated by the addition of mm homocysteine, and then further incubated at 37 °C for 10 The reaction was quenched at 90 °C for min, and the reaction ... 2009 The Authors Journal compilation ª 2009 FEBS K R Wolthers and N S Scrutton nine from 14CH3-H4-folate The rate of 14CH3 incorporation was found to saturate with respect to MSR concentration ... confirming that these two proteins not interact with hMS We have compared the electrostatic potentials for the surface of the CPR FMN domain (in the region of the solventexposed FMN) with that of a...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... set pCR2.1 ⁄ ER ATTTCATCTAATACAGTC GCGGGATCCACGATGTCTCACACCATTTTGC GCGGAATTCTTATTTCCCAGCCTGTTGGGCCTG CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG CTCAAAGCTTGATTTTGAATTCTGTG CTTCTGGCTGCCTCACTCC ... CTTCTGGCTGCCTCACTCC GCGCGATATCGCAAGATGGCGGACATCTCCCTGG CTCAAAGCTTGATTTTGAATTCTGTG GCGGAATTCTCTCACACCATTTTGCTGGT GCGCTCGAGTTATTTCCCAGCCTGTTGGGCCTG GCGGGATCCCACACCATTTTGCTGGTACA GCGAAGCTTTTATTTGTCATCGTCATCCTTGTAGTCTTTCCCAGCCTGTTGGGCCTG ... ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCAGCCCATCCTGCTGCGGCTG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT GCGGGATCCCAGCCCATCCTGCTGCGGCTG ATAAGAATGCGGCCGCTCAGGGCTGCGTGGTCACAGAGGC GCGGGATCCCGCAGGGTGAACTCTGCCTCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt
... purification of His-tagged NDH-2 The AtuNDH-2 gene was amplified from A tumefaciens genomic DNA, using the following couple of primers: (F) CGCCAATTGATGCAAGAACATCATGTT; (R) AAAA CTGCAGTCAATGATGATGATGATGATGGGCCTCG ... as indicative Nevertheless, it clearly appears that AtuNDH-2 is able to catalyse the oxidation of NADH in the presence of both quinone acceptors (Table 1) In the absence of acceptors, the enzyme ... preincubated with purified AtuNDH-2 at two protein concentrations (2.5 and lgÆmL)1 final protein concentration, respectively) for 30 before measurements We conclude from these experiments that AtuNDH-2...
Ngày tải lên: 19/02/2014, 06:20