... Verification Strategy 11.3 Interface Verification 11.3.1 Transaction Verification 11.3.2 Data or Behavioral Verification 11.3.3 Standardized Interfaces 11.4 Functional Verification 11.5 Random ... Mulgaonkar, Suzanne Hayek, Pierre Thomas, Alain Pirson, Fathy Yassa, John Swanson, Gil Herbeck, Saleem Haider, Martin Lampard, Larry Groves, Norm Kelley, Kevin Kranen, Angelina So, and Neel Desai ... configurations and parameter values must be documented Any restrictions on configurations or parameter values must be clearly stated Interfacing requirements and restrictions on how the macro can...
Ngày tải lên: 28/06/2014, 18:01
... Takata M, Nakashima M, Takehara T, Baba H, Machida K, Akitake Y, Ono K, Hosokawa M, Takahashi M: Detection of amyloid protein in the urine of Alzheimer’s disease patients and healthy individuals ... label-free biodetection and quantitative DNA-binding assays on a nanomechanical cantilever array PNAS 2002, 99:9783-9788 15 Laiwattanapaisal W, Yakovleva J, Bengtsson M, Laurell T, Wiyakrutta ... with nanoparticles allows detection in confocal and non-confocal modes [98] Nanoparticlebased detection of DNA hybridization and protein binding can be carried out by label-based and label-free...
Ngày tải lên: 10/08/2014, 05:21
Báo cáo y học: "Proteomics studies confirm the presence of alternative protein isoforms on a large scale" pptx
... carry out an initial re-analysis against a locally generated database that contained 903,842 peptides from translated transcripts from predicted gene models, translated pseudogenes and translated ... FlyBase, 3,818 from 6-frame translations of miscellaneous functional RNA (rRNA, small nuclear RNA (snRNA) and snoRNA) from FlyBase and 2,594 were generated from the 6frame translation of transcripts ... [38] as well as a decoy database strategy and was found to be in the low percentage range Most tandem mass spectra as well as their statistical analysis can be viewed in the PhosphoPep database...
Ngày tải lên: 14/08/2014, 21:20
Fabrication of micro and nano fluidic lab on a chip devices utilizing proton beam writing technique
... bio-compatible, disposable, optically transparent and inexpensive [6] Another particular advantage for polymers is that a wide range of fabrication technologies are available to construct polymer-based ... miniaturized separation and detection systems, micro-reactors and micro-mixers, micro-arrays or combinations of the above Analytical operations of the devices involve sample preparation, sample ... and manipulating minute amounts of fluids or biological samples through micro-fabricated channels and allow a fast and automated integration of various biochemical and physical processes to take...
Ngày tải lên: 12/09/2015, 11:29
Integrated array on a chip for genotyping
... GTTCAGCCTGGTTAA QD525 (green) ID2 CAATGCCGATACAGA QD565 (yellow) ID3 TCACGTTTGTCCAGG QD585 (orange) ID4 GTTGTAAAACGACGG QD655 (red) ID5 GGAAATGTCTCAGGT QD525 ID6 GAGTCCGAGAAGAAT QD565 ID7 GGTCTATATAAGCAG ... CTTTATGTTTTTGGC QD655 ID9 TGATGATCCCATTGA QD525 ID10 ACATTACCAACTGCT QD565 ID11 CTAGTACACTGTAGT QD585 ID12 TCACTAGACAATAAC QD655 35 Chapter 3: Materials and Methods 3.3.3 Encoding/decoding beads ... is about 50 times faster than conventional slab gel electrophoresis In another approach, an array of 96 microchannels can be fabricated for capillary array electrophoresis on a circular silicon...
Ngày tải lên: 14/09/2015, 13:07
System on a chip design and test
... HW/SW partitioning and task allocation Partitioning model Create simulation models, analyze and validate Scheduling model Communication model HW/SW interface definition Software specs Hardware specs ... simultaneous analysis and optimization of area, performance, power, noise, test, technology constraints, interconnect, wire loading, electromigration, and packaging constraints Because SoC may also contain ... staff at Artech House had already been hearing and reading a lot about system-ona -chip and was very excited about this project Considering the rapid technology changes, a four-month schedule was...
Ngày tải lên: 08/03/2016, 11:38
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx
... resolution of the transition state dynamics of a chemical reaction obtained using forceclamp techniques makes a novel contribution to our understanding of protein based chemical reactions Conclusions ... transition state is characterized by two parameters: the size of its activation energy, DGu, and the elongation of the protein necessary to reach the transition state, Dxu.[39, 45] Of particular ... proteins to a fully extended unfolded state.[37] This level of experimental control allows statistical examination of the unfolding and folding pathways of a protein[ 38–42] and a chemical reaction[43]...
Ngày tải lên: 22/03/2014, 18:20
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt
... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... towards pNPP at an acidic pH, around 5.5, and Tt SurE was maximally active at pH 8.2 St SurE shows almost no activity in the absence of divalent metal ions Activation by various metal ions was ... Crystal structure and functional analysis of the SurE protein identify a novel phosphatase family Nat Struct Biol 8, 789–794 Zhang RG, Skarina T, Katz JE, Beasley S, Khachatryan A, Vyas S, Arrowsmith...
Ngày tải lên: 18/02/2014, 14:20
Báo cáo khoa học: Fully active QAE isoform confers thermal hysteresis activity on a defective SP isoform of type III antifreeze protein docx
... successive stacking of hexagonal ice plates on the basal plane, leading to the formation of an ice bipyramid, as illustrated in Fig When pyramidal planes are created by the adsorption of AFPs, the ... retention of the c- : a- axis ratio at approximately 3.3 for flounder type I AFP mutants that accumulate onto a {20 21} pyramidal plane Significantly, a similar continuous growth of the ice bipyramid ... first basal plane [14], thereby creating a hexagonal ice plate that is smaller than the first layer Repeated binding of AFP to the prism plane and the generation of a smaller ice nucleus cause successive...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: ThermoFAD, a ThermofluorÒ-adapted flavin ad hoc detection system for protein folding and ligand binding pdf
... Polyamine oxidase L-Galactono-c-lactone dehydrogenase Flavin-dependent monooxygenase Monoamine oxidase B Alditol oxidase Mammal (Homo sapiens) Non-covalent FAD [23] 1.0 48.1 48.4 Plant (Zea mays) ... structural characterisation (Table 1) Their purity was checked by SDS–PAGE analysis, and protein concentration was evaluated by measuring the UV ⁄ vis absorbance of the bound flavin cofactor using ... Evaluation of in vitro reconstitution of a protein complex using ThermoFAD C Fig (A) Evaluation of FMO stability using ThermoFAD against various buffers at various pH values (B) ThermoFAD comparison...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo hóa học: " Green fluorescent protein as a reporter of prion protein folding" potx
... Williamson RA, Legname G, Matsunaga Y, Vergara J, Burton DR, DeArmond SJ, Prusiner SB, Scott MR: A change in the conformation of prions accompanies the emergence of a new prion strain Neuron 2002, ... Peretz D, Ball H, Sakurai H, Legname G, Serban A, Prusiner SB, Burton DR, Williamson RA: Immobilized prion protein undergoes spontaneous rearrangement to a conformation having features in common with ... were separated on pre-cast 10% Tris-HCl SDS-polyacrylamide gels (Bio-Rad) and transferred onto Immobilon-P transfer membrane (Milli- Additional File Additional figure Cartoon and flow diagram of...
Ngày tải lên: 20/06/2014, 01:20
Immobilizing topoisomerase I on a surface plasmon resonance biosensor chip to screen for inhibitors pptx
... DNA migrated faster on the agarose gel than did relaxed circular DNA shown in the control (Fig 2B, lanes and 2) CPT treatment inhibited TopI relaxation activity, and a greater amount of uncatalytic ... phosphorylation proximal to DNA breakage sites which spreads to adjacent areas of chromatin [31] Increasing γH2AX levels in a concentration-dependent manner upon EVO treatment in A2 780 cells are consistent ... analyzed after subtracting that from the blank channel After each measurement, the surface was regenerated with 0.5 M NaCl in 0.05 M NaOH DNA relaxation assay Data processing and analysis The inhibitory...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: "Rapid self-assembly of DNA on a microfluidic chip" docx
... such as "micro-total analysis systems" and "lab -on- a- chip" These microchips have been demonstrated in conjunction with a range of applications that integrate the polymerase chain reaction (PCR) and ... noted that the emphasis of this work is on inducing the formation of dsDNA and ssDNA on- chip rather than upon improving mutation detection Simultaneous Analysis of ssDNA and dsDNA As expected, after ... denaturation and renaturation processes on- chip Reassembly of dsDNA In order to confirm that we are reassembling DNA on chip rather than denaturing to varying degrees we investigated Page of 10 (page...
Ngày tải lên: 11/08/2014, 00:22
Báo cáo y học: " The carbohydrate at asparagine 386 on HIV-1 gp120 is not essential for protein folding and function but is involved in immune evasion" potx
... cell and virion surface, was concentrated using Amicon centrifugal filter units (Millipore) and SDS was added to a 1% final concentration Gp120 in cell, virion and supernatant fractions was measured ... revertant are from day 77 ( 2a) and day 136 (2b) after transfection Revertant also contained reversions outside the indicated domain: T188N, N230D and R696K at day 77, and A3 16T, N339Y in addition ... transfecting C3 3A cells with the appropriate pLAI constructs The virus containing supernatant was harvested days post-transfection, filtered and stored at -80°C and the virus concentration was...
Ngày tải lên: 13/08/2014, 06:20
Báo cáo y học: "Nucleic acid chaperons: a theory of an RNA-assisted protein folding" ppt
... T A T T A C A G CG C T G A 3rd 2nd C G A A T G A T A T T A C A G CG C T G A G 2nd 1st G T G G T G C A A CT A A C C AC AT A G T T 1st X CT CT AG CT X CT ACT AG XAG G CT X AG AGX CTX X X G CT AA ... http://www.tbiomed.com/content/2/1/35 Figure RNA-assisted (translational) protein folding RNA-assisted (translational) protein folding There are three reverse and complementary regions in a mRNA (blue line, A) : aa', ... indicated in Table I This partial, suboptimal complementarity again suggests that mRNA folding may assist protein folding, but does not necessarily prove it An alternative explanation is that it...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: "InSite: a computational method for identifying protein-protein interaction binding sites on a proteome-wide scale" pot
... co-expression and GO distance, which are noisy sensors for the actual interaction variable Tij.I Note that an actual interaction variable may have several observation variables if the pair appears in ... contributions All authors read and approved the final manuscript Additional data files 13 14 15 16 17 The following additional data are available with the online version of this paper Additional ... interactions and 18,666 gold standard non-interactions, and a total of 108,924 observations (Figure S8 in Additional data file 2) non-interactions [35] and removed those that appear in any interaction...
Ngày tải lên: 14/08/2014, 08:20
Some studies on a probabilistic framework for finding object-oriented information in unstructured data
... the 22nd international conference on Machine learning [10] Eric Chu, Akanksha Baid, Ting Chen, An-Hai Doan, and Jeffrey F Naughton A relational approach to incrementally extracting and querying ... solution based on its approach with different advantages, however, they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information ... website usually has its structured information such as location, number of bedrooms, price and area A professor homepage usually contains information about his education, email, department and the...
Ngày tải lên: 23/11/2012, 15:04
The 25 most difficult questions you'll be asked on a job interviewThe 25 most difficult questions you'll be asked on a job interview
... For example, if the organization is known for strong management, your answer should mention that fact and show that you would like to be a part of that team If the company places a great deal of ... good manager? Can you give me some examples? WWW.RabElMagd.com WWW.RabElMagd.com Do you feel that you have top managerial potential? Keep your answer achievementand ask-oriented Rely on examples ... more at your age? Say that this is one reason that you are conducting this job search Don't be defensive 23 What you feel this position should pay? Salary is a delicate topic We suggest that you...
Ngày tải lên: 07/02/2013, 09:37