prompting the selection of a workspace on startup

Ngày tải lên: 12/06/2014, 11:36

... two-tailed Spearmans coefficient (r) for non-parametric correlations A P value of less than 0.05 was regarded as significant Software package STATA 9.0 (USA) was used for the analysis Materials and Methods ... and after the initiation of NARP can be seen in table A negative correlation was observed between the ceftriaxone consumption and the prevalence of ceftriaxone resistant E.coli and Klebsiella ... financial cost and resistance patterns of leading nosocomial pathogens (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer databases, and 2) International...

Ngày tải lên: 25/10/2012, 11:00

... Overhead view Fig - Schematic diagram of the AUFB reactor Reactor Setup and Operation for the Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular ... Japan) RESULTS AND DISCUSSION Effect of Surface Loading and Aeration Rates on the Selection of Well-Settling Sludge As we expected, the increase in both surface loading and aeration rates strongly ... aerobic granulation in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of aerobic granular sludge By setting and controlling...

Ngày tải lên: 05/09/2013, 10:15

... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the ... mechanical, thermal, and electrical contact between the central parts of the gas diffusion backing and Membrane-Electrode-Assembly (MEA) 2.2 Model equations 2.2.1 Air and fuel gas flow In natural...

Ngày tải lên: 05/09/2013, 14:58

... time variation of solar radiation and average temperature of the present experimental study in August and the theoretical results of [1] in June Figure 10 The time variation of solar radiation and ... time variation of the parameter “average temperature/solar radiation” for August from the present study and the published data [1] for June Figure 14 The time variation of the parameter “average ... vertical layer of water along the tank wall Part of this heat is then transferred by diffusion towards the core of the tank The water of the vertical layer becomes lighter than its surrounding and then...

Ngày tải lên: 05/09/2013, 15:28

... evaluation settings Their major drawback of evaluation is that they focus on the estimation of cash flows and accounting criteria (Kim, Suh and Hwang, 2003) Nevertheless, traditional performance ... information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure soft and qualitative information For example, in the book The Experience Economy ... Skandia Navigator (Edvinsson and Malone, 1997) Value Chain Scoreboard (Lev, 2002) Description of measure Sets of human capital indicators are collected and bench-marked against a database Similar...

Ngày tải lên: 20/12/2013, 17:15

... knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not consist of the processing of information or data, since the obtaining of tacit ... interco-operation, social transformation, universal character, education The mission and corporate values summarize the corporation and the culture of all the firms belonging to it: customer satisfaction, ... will add value and establish learning as a continuous process within the organization The process of implementation of a KM strategy involves the operations of creation, storage, distribution and...

Ngày tải lên: 24/01/2014, 00:20

... studies have typically focused on the spare parts portion of Operation and Maintenance (O&M) accounts, because good maintenance labor hour data are lacking The lack of labor data, as well as the failure ... Studies of an Age-Cost Relationship Cost Data Are Lacking in Key Areas A critical factor hampering studies of an age-cost relationship is the lack of detailed maintenance-related data for all relevant ... Percent AMC Army Materiel Command AMDF Army Master Data File AMSAA Army Materiel Systems Analysis Activity AR Armor Regiment ARI Automatic Return Item ASL Authorized Stockage List AVN Aviation Brigade...

Ngày tải lên: 17/02/2014, 22:20

... ịt ỵ A2 expkHX;2 ịt ỵ A3 where A1 , A2 , and A3 are the fractions of the fast, slow and stable amide protons and kHX,1 and kHX,2 are the apparent exchange rate constants for the fast and slow amide ... conjugates were independent of the size of the glycan (Tables and 5, [36]) The analysis revealed that the changes in these parameters statistically correlate for both the acylation and deacylation ... that other phenomena, such as electrostatic stabilization of the transition state, formation of covalent intermediates, steric strain, near attack conformations, substrate desolvation, low barrier...

Ngày tải lên: 19/02/2014, 05:20

... a regional model of the U.S agricultural sector, Lewandrowski et al examined the potential for carbon sequestration at various carbon prices At a carbon price of $34 per MT CO2e , they estimate ... grassland) Figure shows the regional breakout of the potential carbon dioxide equivalent sequestered through afforestation on cropland and pastureland and through soil management at a carbon price ... price of $34 per CO2e Figure 4—Carbon Sequestration Potential by Region (based on carbon price of $34/MT CO2e) Pacific Mountain Delta States South East Afforestation from cropland Appalachia Afforestation...

Ngày tải lên: 21/02/2014, 01:20

... Poaceae Calamus walkeri Acacia auriculiformis Musaceae Wendlandia glabrata Licuala spinosa Tarrietia javanica Cleistanthus aff myrianthus Melocalamus compactiflorus Afzelia xylocarpa Tools The future ... occurs An old cemetery is situated in the middle of an Acacia plantation, and the remains of abandoned villages can be found around the small tree forest in the village area These land features ... Animal Pahy Latin/English LUVI Pahy/English LUVI Pheo Ki re Tràm Pe A xop A ro Huen Pa lar Tu vien Poaceae/bamboo Calamus walkeri /rattan Acacia auriculiformis/Acacia Musaceae/banana Wendlandia...

Ngày tải lên: 21/02/2014, 04:20

... caused by the drastically decreased rate of primary cleavage of RNase A (Fig 4), as discussed below As a consequence of the breakdown of the tertiary structure of RNase A in concentrations of trifluoroethanol ... chemicals were the purest ones commercially available Determination of RNase A concentration The protein concentration of RNase A stock solution was determined by using the molar absorption coefficient ... Fig was obtained by relating these values to the value determined for 0% trifluoroethanol Analytical ultracentrifugation Analytical ultracentrifugation was carried out on a Beckman Optima XL -A ultracentrifuge...

Ngày tải lên: 22/02/2014, 07:20

... for them to be blinded to the group assignment The participants on the other hand are unaware of the group assignment, as they are under the assumption that the hospital is providing usual care ... This questionnaire aims to evaluate the (satisfaction with) information received by cancer patients on different areas of the disease, diagnosis, treatment and care, and some qualitative aspects, ... information provision, and availability; the other hospital staff’s interpersonal skills and information provision scale; the exchange of information single-item scale; the waiting time; the hospital...

Ngày tải lên: 05/03/2014, 15:20

... Harada T, Taniguchi F, Izawa M, Ohama Y, Takenaka Y, Tagashira Y, Ikeda A, Watanabe A, Iwabe T, Terakawa N: Apoptosis and endometriosis Front Biosci 2007, 12:3140–3151 111 Yamaguchi K, Mandai ... decidual hemorrhage, and maternal-fetal activation of the hypothalamic-pituitary axis, amongst others [239] Of these etiologies, intrauterine infection and inflammation is considered a main contributor ... (TNF)alpha activates the apoptotic cascade, causing cell death Conversely, the antioxidants vitamin C and E, and sulfalazine can prevent this damage by inhibiting the activation of NF-kappa B...

Ngày tải lên: 05/03/2014, 16:20

... consists of a federation of 11 states in Peninsular Malaysia and the states of Sabah and Sarawak in the north of Kalimantan Kuala Lumpur, the national capital, Labuan UNEP/SCS – National Report Malaysia ... Singapore The Straits of Malacca The Straits of Singapore The Straits of Singapore The Straits of Malacca The South China Sea The South China Sea The Straits of Singapore The Straits of Malacca The ... aim of the national report is to review existing information on the use of, and threats to, the Malaysian coastal and marine resources off the Straits of Malacca and the adjacent waters of the Andaman...

Ngày tải lên: 06/03/2014, 15:21

... social dynamic data supplier RepRisk Finally, SAM analysts personally contact companies to clarify any issues that may arise from the analysis of the MSA, the questionnaire, and the company documents ... governance, so that the board can form an opinion about whether management is executing the strategy of the organization well Quality, comparability, and credibility of information and whether management ... Firms: A Model of Myopic Corporate Behavior Quarterly Journal of Economics 104: 655-669 Ullmann, A A 1985 Data in search of a theory: a critical examination of the relationships among social performance,...

Ngày tải lên: 06/03/2014, 20:21

... GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA TATCTGTTAAGTTGTTC-3¢); GLU H44 7A, D45 0A ... (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA ... et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing Glucoamylase Glu Enzyme preparation and...

Ngày tải lên: 07/03/2014, 12:20

... overdetermines the montage’s celebration of spectatorship as accumulation and consumption Accumulation is an endemic feature of the cultural landscape of the information society, according to Scott Lash, ... literalizing the global expansion, yet significatory contraction of moving image culture under globalization The Workman montages of the 1990s pave the way for the spatialized reconfiguration of ... within a discourse of accumulation As images accumulate, our recognition of the movies they are taken from accumulates, and along with it, a recognition of our own cultural capital as cinema-literate...

Ngày tải lên: 07/03/2014, 15:20

... (e) The AMY1 concentration [E]0 was 38.8 lM decreasing to 37.3 lM by addition of acarbose A0 is the AMY1 absorbance without acarbose, A is the absorbance measured at the above acarbose concentrations ... dissociation constants In this equation, it was easier for a calculated constant to compare its value relative to zero rather than to obtain a large value When the association constant value was close ... Statistical analysis of the experimental initial rates (v) was performed using the general MichaelisMenten initial velocity equation for determination of kcat and Km and calculation of the catalytic...

Ngày tải lên: 08/03/2014, 08:20

... FEMA Federal Emergency Management Agency INEEL Idaho National Engineering and Environmental Laboratory NASA National Aeronautics and Space Administration NIST National Institute of Standards and ... Damage Investigation, and the U.S.-Japan Natural Disaster Task Committee on WindHazards He has served on the board of the American Association for Wind Engineering and is a member of the American ... the value of large-scale testing data (as compared to observational data) in the development and validation of computer simulations as a vehicle for (1) public education, (2) the validation of...

Ngày tải lên: 08/03/2014, 19:20