programs using a look up table for ascii

A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor

A biodegradation and treatment of palm oil mill effluent (POME) using a hybrid up-flow anaerobic sludge bed (HUASB) reactor

... Rajakumar, R and Meenambal, T [3] to investigate the performance for each hybrid UASB reactor and anaerobic filter (AF) reactor, where the comparison of this study was mainly compared the start -up ... to be transferred to the analysis laboratory for parameters analysis The related parameters were observed and analyzed daily are Chemical Oxygen Demand (COD), Total Nitrogen (TN), Total Phosphorus ... classical UASB and hybrid UASB-filter reactor Water Science and Technology 2004;49(11):295–301 [3] Rajakumar R, Meenambal T Comparative Study on Start – Up Performance of HUASB and AF Reactors Treating...

Ngày tải lên: 05/09/2013, 16:11

8 409 0
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx

... Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , Hatayama, T & Nagata, ... such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a ... neutral red, and fixed with 1% formaldehyde containing 1% CaCl2 for The dye incorporated into viable cells was extracted with 50% ethanol containing 1% acetic acid, and absorbance at 540 nm was measured...

Ngày tải lên: 17/03/2014, 10:20

8 470 0
The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx

The natural history of non-alcoholic fatty liver disease in children: a follow-up study for up to 20 years pptx

... (serum aspartate aminotransferase (AST), alanine aminotransferase (ALT), alkaline phosphatase activity, c-glutamyl transferase (GGT), total bilirubin, albumin levels and prothrombin time), fasting ... were also common The main laboratory data gathered at the time of NAFLD diagnosis are summarised in table ALT and AST levels were each within the normal range in few patients 1539 Hepatology Table ... specific age and sex in each individual case {Includes the normal laboratory values for boys and girls for the age range of our patient population {Based on percentile for age and sex ALT, alanine aminotransferase;...

Ngày tải lên: 22/03/2014, 10:20

7 487 0
Báo cáo khoa học: "Automatic Story Segmentation using a Bayesian Decision Framework for Statistical Models of Lexical Chain Features" pdf

Báo cáo khoa học: "Automatic Story Segmentation using a Bayesian Decision Framework for Statistical Models of Lexical Chain Features" pdf

... Lexical Chain Features Chain starts and ends We follow (Chan et al 2007) to model the lexical chain starts and ends at a story boundary with a statistical distribution We apply a window around ... approach in (Chan et al 2007) based on the training data The optimal value is found to be 130.9sec for long programs We make use of three lexical chain features: chain starts, continuations and ... We have presented a Bayesian decision framework that performs automatic story segmentation based on statistical modeling of one or more lexical chain features, including lexical chain starts,...

Ngày tải lên: 23/03/2014, 17:20

4 402 1
báo cáo hóa học: " A blow up result for viscoelastic equations with arbitrary positive initial energy" docx

báo cáo hóa học: " A blow up result for viscoelastic equations with arbitrary positive initial energy" docx

... Mathematical problems in linear viscoelasticity SIAM Studies in Applied Mathematics Philadelphia 12 (1992) Cavalcanti, MM, Cavalcanti, VND, Lasiecka, I: Well-posedness and optimal decay rates for ... Alves and Cavalcanti [9], Aassila et al [7], Cavalcanti and Oquendo [19] and references therein Then Messaoudi [20] obtained the global existence of solutions for the viscoelastic equation, at ... nonlinear wave equation of the form Putt = Δu + F(u) Trans Am Math Soc 192, 1–21 (1974) 25 Cavalcanti, MM, Cavalcanti, VND, Ferreira, J: Existence and uniform decay for nonlinear viscoelastic equation...

Ngày tải lên: 21/06/2014, 02:20

10 230 0
Vector sum phase shifter using a quadrature magic t for application in polarization control

Vector sum phase shifter using a quadrature magic t for application in polarization control

... a linearly polarized horn antenna, Fig 1-2 shows a dual linear polarization horn antenna, Fig 1-3 shows a circularly polarized spiral antenna, and Fig 1-4 shows a dual linearly polarized array, ... polarization spiral antenna Fig 1-4: Dual linear polarization array taken from [7] It is important to note that the dual linear polarization antenna can also be converted into a circular polarized ... communication or radar is transmitted through an antenna The polarization of the EM wave is dependent on the polarization of the antenna Antenna polarization is a characteristic of the antenna and...

Ngày tải lên: 30/09/2015, 10:11

144 238 0
STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT

STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING a PROJECT MANAGEMENT

... individuals are not only af- 9755.ch01 10/31/00 9:42 AM Page 5 Gap Analysis fected by the organization’s performance, but may even have a claim on its performance As an example, unions can have a strong ... critical success factors: qualitative factors, organizational factors, and quantitative factors To take advantage of the economic outlook, whatever it happened to be at a given time, senior managers ... Responsibility Evaluation of Information Managerial Values of Management Strategy Evaluation Strategy Selection Strategy Implementation FIGURE 2–1 Basic strategic planning Corporate Strategic Plan Strategic...

Ngày tải lên: 14/08/2013, 13:47

271 630 2
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm

... pp.927-938 935 (a) Best, mean and median objective valuses for Case I (b) Standard deviations for Case I (c) Best, mean and median objective values for Case II (d) Standard deviations for Case II Figure ... optimization for VAWT wind farm The results are given in Table The optimal layout is the same as that of a HAWT as shown in Figure Table Optimization results for VAWT wind farm Optimization Objective ... Table Case III has been taken from the paper of Yan et al [12] and Case III has a double rotor radius compared to Case IV so that the tip-speed ratio also doubles Again, the size of the farm is...

Ngày tải lên: 05/09/2013, 17:03

12 636 1
Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx

Tài liệu Module 3: Using a Conceptual Design for Data Requirements docx

... important to superfluous Validation Information provided is not always accurate, so it is important for the team to validate the information gathered One method of validating information is to gather ... know to perform a function or task Each functional data requirement is directly traceable to an actor and an object within a use case Nonfunctional data requirements A nonfunctional data requirement ... the solution’s overall data design If a solution has no data requirements, it has no need for data storage, let alone a logical data organization Determining the functional data requirements from...

Ngày tải lên: 10/12/2013, 17:15

20 580 0
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university

Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university

... Many compensation strategies are used to compensate for a lack of appropriate vocabulary, but these strategies can also be used to make up for a lack of grammatical knowledge Compensation strategies ... learning style preferences and needs, planning for an L2 task, gathering and organizing materials, arranging a study space and a schedule, monitoring mistakes, and evaluating task success, and ... there are two influential views: traditional view and alternative view They thought that traditional view was inappropriate and inadequate because the listener was regarded as a tape-recorder and...

Ngày tải lên: 27/12/2013, 20:26

99 806 0
Tài liệu STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING A PROJECT MANAGEMENT MATURITY MODEL ppt

Tài liệu STRATEGIC PLANNING FOR PROJECT MANAGEMENT USING A PROJECT MANAGEMENT MATURITY MODEL ppt

... individuals are not only af- 9755.ch01 10/31/00 9:42 AM Page 5 Gap Analysis fected by the organization’s performance, but may even have a claim on its performance As an example, unions can have a strong ... critical success factors: qualitative factors, organizational factors, and quantitative factors To take advantage of the economic outlook, whatever it happened to be at a given time, senior managers ... Responsibility Evaluation of Information Managerial Values of Management Strategy Evaluation Strategy Selection Strategy Implementation FIGURE 2–1 Basic strategic planning Corporate Strategic Plan Strategic...

Ngày tải lên: 16/01/2014, 16:33

271 465 3
Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf

Tài liệu Instructor Notes Module 3: Using a Conceptual Design for Data Requirements pdf

... be able to: • Discuss use cases, data requirements, and requirements validation as they relate to conceptual design for data systems ! To prepare for the activity • Review the activity and anticipate ... Module 3: Using a Conceptual Design for Data Requirements Activities Activity 3.1: Identifying Data-Related Use Cases and Data Requirements In this activity, students will determine data requirements, ... Many students with database backgrounds will want to think and work in the physical data model Remind them that, at this point, the work is still in the conceptual phase THIS PAGE INTENTIONALLY...

Ngày tải lên: 17/01/2014, 09:20

4 447 0
Tài liệu Create a Point-and-Click Query Tool for Users Using a Web Form pptx

Tài liệu Create a Point-and-Click Query Tool for Users Using a Web Form pptx

... string is passed to a DataAdapter control, filling a data table From there, the data is displayed when the data source of the DataGrid control is set to the data table Users can change the sort ... Specified Data Private Sub btnView_Click(ByVal sender As System.Object, _ ByVal e As System.EventArgs) Handles btnView.Click Dim odaDisplay As OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() ... buttonface Label Name Label1 Text Tables Name Label2 Text Columns Name Label3 Text SQL String Name Label4 Text Data Display Name lstTables AutoPostback True Name lstColumns SelectionMode Multiple AutoPostback...

Ngày tải lên: 26/01/2014, 11:20

10 384 0
Tài liệu Create a Point-and-Click SQL Server Query Tool for Users Using a Windows Form doc

Tài liệu Create a Point-and-Click SQL Server Query Tool for Users Using a Windows Form doc

... create a data table; then set the ' data source of the data grid odaDisplay = New OleDb.OleDbDataAdapter(Me.txtSQLString.Text, mcnn) odaDisplay.Fill(dtDisplay) Me.dgDisplay.DataSource = dtDisplay ... btnView_Click(ByVal sender As System.Object, _ ByVal e As System.EventArgs) Handles btnView.Click Dim odaDisplay As OleDb.OleDbDataAdapter Dim dtDisplay As New DataTable() Try ' Take the txtSQLString text and ... mcnn.Open() ' Create the DataReader object odrTables = ocmdTables.ExecuteReader() ' Loop through and add table- type object names ' to the lstTables list box Do While odrTables.Read If odrTables.GetString(3)...

Ngày tải lên: 26/01/2014, 11:20

9 490 0
Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx

Tài liệu Enhancement of aesthetic treatment planning and communication using a diagnostic mock-up pptx

... correct shade for direct composite resin restorations and can serve as a practical chairside alternative to the diagnostic wax -up It can also be used to create a lingual matrix for multilayered ... entails making a silicone matrix from the diagnostic wax -up and filling it with an auto-cure resin temporary material before placing it intra-orally The diagnostic mock -up is therefore a replica ... would change the appearance of her teeth considerably At the second appointment, the treatment plan was explained to the patient using the diagnostic wax -up and the unaltered original cast A diagnostic...

Ngày tải lên: 19/02/2014, 17:20

5 378 0
Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc

Tài liệu Báo cáo khoa học: "Using Multiple Sources to Construct a Sentiment Sensitive Thesaurus for Cross-Domain Sentiment Classification" doc

... negative sentiment) given a small set of labeled data for the source domain, and unlabeled data for both source and target domains In particular, no labeled data is provided for the target domain ... techniques In EMNLP 2002, pages 79– 86 Patrick Pantel and Deepak Ravichandran 2004 Automatically labeling semantic classes In NAACLHLT’04, pages 321 – 328 Sunita Sarawagi and Alok Kirpal 2004 Efficient ... spectral feature alignment technique of Pan et al (2010) Both the LSA and FALSA techniques are based on latent semantic analysis (Pan et al., 2010) For the Within-Domain baseline, we train a binary...

Ngày tải lên: 20/02/2014, 04:20

10 556 0
Tài liệu Báo cáo khoa học: "Refined Lexicon Models for Statistical Machine Translation using a Maximum Entropy Approach" pptx

Tài liệu Báo cáo khoa học: "Refined Lexicon Models for Statistical Machine Translation using a Maximum Entropy Approach" pptx

... References Yaser Al-Onaizan, Jan Curin, Michael Jahr, Kevin Knight, John Lafferty, Dan Melamed, David Purdy, Franz J Och, Noah A Smith, and David Yarowsky 1999 Statistical machine translation, final report, ... 36th Annual Meeting of the Association for Computational Linguistics and 17th Int Conf on Computational Linguistics, pages 960–967, Montreal, Canada, August Franz J Och and Hermann Ney 200 0a Giza++: ... SQ for the word pair categories of features: and and and and and and ‡ Category 2 3 t Alig word ( ) Examples of specific features and their respective category are shown in Table n % 5¤ f Feature...

Ngày tải lên: 20/02/2014, 18:20

8 427 0
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf

... GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG CAAGATAAACGAAGGCAAAGTTCAATTCA TCATTTTTTTTTTATTCTTTT GGAGCCATAATGACAGCAGT ... GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA ... GAGAGAATTCGGGGGACCGTCAGTCTTCCT CTTCCCCC TTCCGAATTCTCATTTACCCGGAGACAGGG CCCCGCGGCCGCTGACACCGATTATTTAAA TTTTGAGCTCGGAGCCATAATGACAGCAGT TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA...

Ngày tải lên: 16/03/2014, 01:20

9 444 0
Báo cáo khoa học: "Evaluating Centering-based metrics of coherence for text structuring using a reliably annotated corpus" doc

Báo cáo khoa học: "Evaluating Centering-based metrics of coherence for text structuring using a reliably annotated corpus" doc

... Workshop on NLG, pages 98–107, Niagara-on-theLake, Ontario, Canada Eleni Miltsakaki 2002 Towards an aposynthesis of topic continuity and intrasentential anaphora Computational Linguistics, 28(3):319–355 ... centering approach to pronouns In Proceedings of ACL 1987, pages 155–162, Stanford, California Barbara Di Eugenio 1998 Centering in Italian In Walker et al (Walker et al., 1998b), pages 115–137 Aggeliki ... C are treated as the random factor in a repeated measures design since each BfC contributes a score for each metric Then, the classification rates for Mx and My on the BfCs are compared with each...

Ngày tải lên: 17/03/2014, 06:20

8 608 0
QUALITATIVE RESEARCH FOR IMPROVED HEALTH PROGRAMS: A Guide to Manuals for Qualitative and Participatory Research on Child Health, Nutrition, and Reproductive Health doc

QUALITATIVE RESEARCH FOR IMPROVED HEALTH PROGRAMS: A Guide to Manuals for Qualitative and Participatory Research on Child Health, Nutrition, and Reproductive Health doc

... methods and techniques of qualitative data analysis (QDA), and especially in the area of computer-aided qualitative data analysis, has a web page that offers useful information, references and links ... and Integrated Development Approach PLA Participatory Learning and Action PLAN An international, humanitarian, child-focused development organization PRA Participatory Rural Appraisal PROWESS ... 3—Methods for Qualitative Data Analysis is organized into two parts Part I, Analyzing textual data, reviews a number of options for analyzing textual data based on in-depth interviews and focus group...

Ngày tải lên: 23/03/2014, 06:20

194 446 1
w