Ngày tải lên: 13/11/2014, 09:14
... evaluation metrics cannot be avoided, but ideally, a metric for the evaluation of realisation rankers would rank alternative real- isations in the same way as native speakers of the language for ... Computational Linguistics Human Evaluation of a German Surface Realisation Ranker Aoife Cahill Institut f¨ur Maschinelle Sprachverarbeitung (IMS) University of Stuttgart 70174 Stuttgart, Germany aoife.cahill@ims.uni-stuttgart.de Martin ... inter alia ex- act match, string edit distance, NIST SSA, BLEU, NIST, ROUGE, generation string accuracy, gener- ation tree accuracy, word accuracy (Bangalore et al., 2000; Callaway, 2003; Nakanishi...
Ngày tải lên: 22/02/2014, 02:20
A PROFILE OF WOMEN’S HEALTH INDICATORS IN CANADA pptx
... in Canada, Ottawa, October, 2002. 16 Health Canada, Health Canada’s Gender-based Analysis Policy, Ottawa, 2000, page 1. 17 Health Canada, Health Canada’s Women’s Health Strategy, Ottawa, ... Health Canada’s Gender-based Analysis Policy, Ottawa, 2000, page 3. 3 Health Canada, Health Canada’s Gender-based Analysis Policy, Ottawa, 2000, page 4. 4 Health Canada, Health Canada’s Women’s ... 14 Statistics Canada, Access to Health Care Services in Canada 2001, catalogue no. 82-575-XIE, June, 2002, and Statistics Canada, CANSIM II database. 15 Health Canada, A Report on Mental Illnesses...
Ngày tải lên: 05/03/2014, 13:21
Strong reproductive barriers in a narrow hybrid zone of West-Mediterranean green toads (Bufo viridis subgroup) with Plio-Pleistocene divergence pptx
... of Lausanne, CH-1015 Lausanne, Switzerland. 2 Dipartimento di Biologia Animale, University of Palermo, Via Archirafi, 18, 90123 Palermo, Italy. 3 University of Catania, CUTGANA, Section of Nature ... estimated hatching success, numbers of tadpoles at 7 day and two months after spawning, percentage of survival two months after spawning, remarks and survival at day 40 after metamorphosis for each ... In each case, we choose a BioNJ as a starting tree, and optimized top ology, branch length and rate parameters. Other parameters were used as defaults of the program. We generated bootstrap values...
Ngày tải lên: 05/03/2014, 17:20
Báo cáo Y học: Interaction of bovine coagulation factor X and its glutamic-acid-containing fragments with phospholipid membranes A surface plasmon resonance study pdf
... entire protein has an on-rate that is two orders of magnitude faster than for the Gla-domain presumably due to a further stabilization of the structure of the Gla-domain, indicating that less than 1% of the ... S.R., Talaga, P., Kamerling, J.P. & Vliegenthart, J.F. (1999) Characterization of the carbohydrate binding specificity and kinetic parameters of lectins by using surface plasmon resonance. Anal. ... phase concentration of factor X (d), factor Xa (m), DEGR-factor Xa (n), Gla–EGF NC (e), Gla–EGF N (r)andGla (.). Solid lines indicate the least-square fit of the Langmuir model to this data as...
Ngày tải lên: 08/03/2014, 23:20
A PROFILE OF DIETARY SUPPLEMENT USE OF ELDERLY IN TWO WISCONSIN COUNTIES pdf
... myocardial and cerebral vascular accidents) is a major cause of hospitalization and death. (Timiras 1994, 199) Cancer, stroke, chronic obstructive pulmonary disease, influenza, and pneumonia are ... (Wellman et al 1997) Another disabling disease of aging is Alzheimer’s and varying degrees of dementia, which are also, frequent causes of hospitalization and death in the aging. (Timiras 1994, ... using aspirin ranged from an undetermined amount to 800 IU and a physician, again, was cited as an information source. None of the subjects were taking coumadin and HM Dosages of Alpha-Tocopherol,...
Ngày tải lên: 14/03/2014, 17:20
Báo cáo khoa học: Cofactor-independent oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode pot
... 2) complex in the absence of catalase and the electrode was held at a negative potential for 30 min to enable any oxidation products to accumulate (as described in materials and methods), no such ... oxygenation reactions catalyzed by soluble methane monooxygenase at the surface of a modified gold electrode Yann Astier 1 *, Suki Balendra 2 , H. Allen O. Hill 1 , Thomas J. Smith 2† and Howard Dalton 2 1 Chemistry ... SCE, saturated calomel electrode. Enzymes: methane monooxygenase (EC 1.14.13.25). Note: a web site is also available at http://www.bio.warwick.ac.uk/ dalton/ Note: Y. Astier and S. Balendra made...
Ngày tải lên: 17/03/2014, 09:20
Báo cáo khoa học: Creation of a new eye lens crystallin (Gambeta) through structure-guided mutagenic grafting of the surface of bB2 crystallin onto the hydrophobic core of cB crystallin pot
... plasmid. The gene was amplified from this plasmid by PCR using for- ward primer 5 ¢-ACTTATACTATCCATATGGGTAAAAT CATCTTCTTTGAACAGG-3¢ and reverse primer 5¢-ACT- TATACTATCCTCGAGCCACTGCATATCACGGATAC GACGC-3¢. ... cDNA for cB using forward primer 5¢-ACTTATACTACT CATATGGGGAAGATCACTTTTT ACG-3¢ and reverse primer 5¢-ACTTATACTATC CTCG AGATAAAAATCCATCACCCG-3¢, and digested this with restriction enzymes NdeI and ... laboratory. References 1 Kapoor D, Kumar V, Chandrayan SK, Ahmed S, Shar- ma S, Datt M, Singh B, Karthikeyan S & Guptasarma P (2008) Replacement of the active surface of a thermo- phile protein by that of a homologous...
Ngày tải lên: 23/03/2014, 04:21
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... virion surface Lyudmila A. Baratova 1 , Nataliya V. Fedorova 1 , Eugenie N. Dobrov 1 , Elena V. Lukashina 1 , Andrey N. Kharlanov 2 , Vitaly V. Nasonov 3 , Marina V. Serebryakova 4 , Stanislav V. ... peptide. Monosaccharides were analyzed as AMC derivatives. (A) Analysis of a blank sample ( eluate fraction between peaks in chromatograp hic profile shown in Fig. 3). (B) Analysis of a stan dard mixture containing ... a stan dard mixture containing Glc, Gal, Man, Fuc, GlcNAc, GalNAc, ManNAc. (C) Analysis of peak 1 (Fig. 3A) . (D) A nalysis of peak 2 (Fig. 3A) . 3140 L. A. Baratova et al.(Eur. J. Biochem. 271)...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "Correlating Human and Automatic Evaluation of a German Surface Realiser" doc
... of automatic evalua- tion methods for generation in terms of adequacy and fluency on automatically generated English paraphrases. They find that the automatic metrics are reasonably good at measuring ... of the ACL-IJCNLP 2009 Conference Short Papers, pages 97–100, Suntec, Singapore, 4 August 2009. c 2009 ACL and AFNLP Correlating Human and Automatic Evaluation of a German Surface Realiser Aoife ... a surface realisation system, it is important to be able to quickly and au- tomatically evaluate its performance. The evalua- tion of a string realisation system usually involves string comparisons...
Ngày tải lên: 23/03/2014, 17:20
A Profile of Women’s Health in the United States ppt
... disease N /A N /A N /A N /A N /A N /A N /A N /A N /A 81.2 N /A 31.0 Anemias N /A 1.2 N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A *Persons of Hispanic origin may be of any race. **Data available for 10 leading ... 4.2 N /A N /A N /A Congenital 1.0 1.4 — N /A N /A N /A N /A N /A N /A N /A N /A N /A anomalies Complications of N /A 1.2 — N /A N /A N /A N /A N /A N /A N /A N /A N /A pregnancy, childbirth, and puerpium Alzheimer’s ... 10 leading causes of death in each age-race/ethnicity group; data are not available for Asian/Pacific Islander or Native American women. N /A: the cause is not a leading cause in that group. —Figure...
Ngày tải lên: 28/03/2014, 12:20
2012 Small Business Profile - A profile of small business in British Columbia pot
... 15% Northeast North Coast & Nechako Cariboo Kootenay Thompson-Okanagan Mainland/Southwest Vancouver Island/Coast 0.6% = Provincial average Small Business Profile | 2012 page 19 FIGURE 3.3 AvERAGE ... United States. Asia has been the principal market for growth of B.C.’s exports, particularly China. With British Columbia positioned as Canada’s gateway to the Asia Pacific, both small and large ... earned an annual salary of $38,811, compared to $46,594 for employees of large business, which amounts to a difference of about $7,800. It is likely that at least part of this wage gap is related...
Ngày tải lên: 29/03/2014, 19:20
improving near field confinement of a bowtie aperture using surface plasmon polaritons
... 2 phase modulation when the wave propagates to and reflects from the groove. A close examination of Fig. 2͑b͒ indicates that SPP waves are excited at the edges of each groove and stronger fields are ... produce standing waves matching the SPP wavelength. Superposition of these stand- ing waves and the emerging field at the slit leads to a nar- rower field. When changing the film and media materials, ... bowtie aperture and another surface is not desirable. The authors gratefully acknowledge the support of the National Science Foundation ͑Grant No. DMI-0707817͒, the Defense Advanced Research Projects...
Ngày tải lên: 06/05/2014, 08:53
báo cáo hóa học:" Validation of a Greek version of the Oral Health Impact Profile (OHIP-14) for use among adults" pdf
... sponsored by a Colgate Palmolive Company grant. 1 Validation of a Greek version of the Oral Health Impact Profile (OHIP-14) for use among adults Vassilia Papagiannopoulou 1 , Constantine J Oulis ... discriminant validity was evaluated by examining the association between the OHIP-14 total score and participants’ dental status as assessed by the clinical examination. Mann-Whitney or Kruskal-Wallis ... Theodorou M, Mastrogiannakis T, Mamai-Chomata E, Polychronopoulou A, Athanasouli T: Oral health status and treatment needs of the Hellenic population -a pathfinder survey-proposals for improvement....
Ngày tải lên: 20/06/2014, 16:20
Báo cáo toán học: " Spin-related tunneling through a nanostructured electric-magnetic barrier on the surface of a topological insulator" potx
... Lin H, Bansil A, Grauer D, Hor YS, Cava RJ, Hasan MZ: Observation of a large-gap topological-insulator class with a single Dirac cone on the surface. Nat Phys 2009, 5:398 [12] Chen YL, Analytis ... Qian D, Wray L, Xia Y, Hor YS, Cava RJ, Hasan MZ: A topological Dirac insulator in a quantum spin hall phase. Nature 2008, 452:970 [10] Hsieh D, Xia Y, Wray L, Qian D, Pal A, Dil JH, Osterwalder ... topological insulators have robust and simple surface states consisting of a single Dirac cone at the Γ point [8]. Note that this Hamiltonian appears similar to graphene [13], but topological insulators...
Ngày tải lên: 20/06/2014, 20:20
Báo cáo hóa học: " Properties of nanocones formed on a surface of semiconductors by laser radiation: quantum confinement effect of electrons, phonons, and excitons" pptx
... Onufrijevs and Alexander Mychko Abstract On the basis of the analysis of experimental results, a two-stage mechanism of nanocones formation on the irradiated surface of semiconductors by Nd:YAG laser ... in nanocone is a special case, since diameter of nanocone is a monotonous function of height, leading to gradual change of bandgap. Graded bandga p structure has an effect on properties of particles and ... surface of Si like a thin film. As a result, LRA stage gradually tran- sits to SLA stage. The second stage, SLA, is characterized by formation of nanocones on the irradiated surface of a semiconductor by...
Ngày tải lên: 20/06/2014, 22:20
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc
Ngày tải lên: 22/06/2014, 00:20
Báo cáo toán học: "A Decomposition Algorithm for the Oriented Adjacency Graph of the Triangulations of a Bordered Surface with Marked Point" potx
Ngày tải lên: 08/08/2014, 14:23